Description :
From Genome Similarity Track
Location :
Scaffold_135:8571- 10583
Transcript NameFunction/comments
Physo_143308reverse transcriptase

Sequence
2012 bases(100 bases per row)
GCTGCTTCAAACGCAAGTGTTTGCCACTCCCGATAGCGGTTTGAATCCTTCCTAGCGAATCCAGGTCGACGCGGGATCTGCCCAACGGGTAACCAGATTG
CCAAACACACCAAACGATCCAGTACCAGGCGGCTCGTGCTGATGTTGGTGATCCGGAGGTATGACTTGTTACTGAATCCACCATTCACCACCATGATCAC
CCATTTTTCCCCTCTCGTTACCCACAGTTCAAACCGCTTGTTGTGGGACTTGAGTGAGATCTCTGTCCATTGGCCAGGACCGACATCATGGAATCCCGTT
GCGTAGACCGCGTCAGCCTTGCTGCTATACAGTGGCTTACGGTCGGTCATCTGGATGCGAACTTCGTCCGGCAGACAGAGCGTTCCGTCAGCCAGGTCCA
ACCTCACCCCCGCAGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCACACACGGAACTTGTACACCAACTCTCCAGC
CAGAGGGAGCTTGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCACACCAACACAATCCATTGTCTGTGTTGTATCAATTTCACAACCCACC
TTACGTGCAAAGGTAGAGTCGATTATCGACACTTCGGCTCCAGTATCAAAGAGTAGGACGGCACGGACATTGTTGACCGCACCGGTCGCCTTCGACTGGT
TGAACCACTTGGAGGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTCGAAGGGCCATCACACAAGGGCGACGCGAATAGTCATCTTC
ATCCGAGGTAAGAGATCTGGCTGTATTCACCGCATTACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTCCTCTGAACATATGCATAAATGCAGAACTTC
GATCGCTCGTCACGTACCAGGCTGTTCAGGCTGTTCAGGCCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTCGGGCAGCAGTCCGGCATGGCG
AGTCGGGTTGTACCATTGGCGAACAGCATCGAAGAAGCCGCCGATTTTACACTGACCTGCTTCGTGAACGTCTCCACAGCACTTGCAGACGTAGAAGCAC
TTGTCGGTAGGATGGCCCATGCGTCCACACTTCTGGCACGTGAGCCTCTTCCAGCACCCGAGATCCGTATGCTTGCGAGATCCGCAGTGTGAGCATCGAG
TGCCGTACTTCGGGCGCCCCAGTTGGTCTTCGCGGTCTTTGCGCGCCCTTGGCTGTTCACCATCTCCTGGTGTAGGTGTCCTAGCTGCCGAAAACACGTG
AGCTCTTTAGTCTTCAGATTCGCTATCGGAACTGCTTGATTCGCCCTCGAACTCGTTGAGATCTCCGTGATCTCCGCGGCGTCCGCGACCGGTAGTCACA
ACCCGCACCGCCCTCGAGGAGGCTGCAGGGGCGGGAGCCCTTTGGCGGTATTTCGAACCTTGGGTCTCAATCTTGCGACGTTGGTGGCGGCGTCGCATGG
CCAACAGGACGCCTTCGAGAGCTTCTGAGTCAGGCAGCCTCAACACTACCAGAGATCCGGCGAGATCGTCATCTTGGACTGTATCGATGTAGTGGTTGAC
GTGTTCACGTCGTTGTTCCTTGGTGCCATCATGGATCTTCAAGTTTGCACGTATCCCGGCCAGATTCAGCCGGTATAAGTAAACCAGTGGGTCTTCCTGA
CTCCCGCGCAGCATGTGGTAGTACTTGCGCGCGAGGGAGATCCCTTTACCGCAAAAGTGGATCTGGAACTGATCACGCAGGTCAGTCCACGACGCGCGAG
CGGTGCGGCTCAGCTGGTAATACCAATTGCGTGCAGGGCCTATCATCAAATCGGCAAATGTCAAGCACATCTCGTCTGGCTGCATCTGATCCCGTCGGAA
AGCCGTTCTAACCTTGTTGAACCAGGCACGGGCGGCTTCTTCGTCATGTTCCTTGCCGCTGAAGTCCTTCAGTTTGGACACAGCCGATGCTCGCAACCTA
GTCGCCGTGGAC