Description :
From Genome Similarity Track
Location :
Scaffold_813:857- 2103
Transcript NameFunction/comments
Phyag_g8170hypothetical protein

Sequence
1246 bases(100 bases per row)
tgctgctgctgttgctgcgagCCGCTCGTCTCGGAAATGTCCGGTTTGTAGTTGACAAAAGTGGAGACACCCTTGATAGTCTTAAGTGCAGTCCCCCCAT
TCCGAGAGTCaaagctgccgctgttctCCAGCGTGTTGGCCTCGCATGAACGGCCCAGGTAGCTGGAGCACTCGTCATTGCTACCGGCAGCGTACAGAGC
TCCATCATTGCCAGTGTAGAGCGGCATCttggtgttgctgaagacgttGCCCTCAGCAAGCACCCAAGCGTTCGAGCCGATCTCGAACGAGTGACCAGTG
TTGTTTCCCCAGAAGTTGTTGGCAACGTGGGCGACGACCTTAGCGGCGCTATCACCGCCAATTTTGGGGGAACGACCCGACGTGCCGTGGATGTAGTTGT
TCAGCATACTGAAGCGAGTAACGCCGTAGAAGATGAATGACCAGTAGTGGTGGCCATCGCACGATGCAGAGTAGTCCGTGTTGCCGTCGAAATCCGAGTT
ACTGATGGTCATCGAGTCGGTGCTGGCCTTGTTGGTCGTGATGAACTGGCGGCCGACCTTGGAGATCTTGATGTGGTCGAGCCaaatcttcttcatggcc
gtGTTGCCACCGTTGGTGCCCTGCATGTAGATGGCATCACCACCCCACACCAAGTGATGGTTCAACTCCGTGATGTGGACATTCTGCACGATGATGTTGT
CACCGTTGAGGGTGAGGCCCTTGCCCTTGATCACGCCGGTCTTGCCGATACCACGAATGGTCTTGTTACCCGTCACGGTCATGCGCTTCAAAGCAGCGTT
GTCGTATTTCACCGTCACCTCGGTGCCGCCCGTGCAACCACCAGTGTTGGCCATGCCGCCGCTCTGAAGGATCACATCCTGACTTTTGTAGccgttgttc
ttggccatgcaCTCACGGGTGTAGTCCGGTCGGCAGCCCTTctccgtggtggtgccctCCGTGCCGCGGAAGTCGAAGGTCTTGTTCAGCACGATCACGA
GAGGGTCGTTCGAGGCGAGGTACGACACCAACTCATCGTTCGAGGCGGGGTACACGGTCTtgccgccagctccaccgGTGGTTCCTGCGGCCAGGCCAGC
GGGCGACCCAATGGTGAAAGCGCTAGCGCAGTCAGCGATGAgagccaacgcagcagcaagggcgAGGTGGACGCGGACCATGATGAAGGCTGTGAAGTGC
TTGTGTCGTGGTCGGAGTGCTTGAGGCGAGGCAAATTTGAGAATGA