Description :
From Genome Similarity Track
Location :
Scaffold_17:85698- 87319
Sequence
1621 bases(100 bases per row)
CCCATTACACCTGGTAGCACTTTGTAGTCCTTCCAGCGACCACAACCACCTCACCTGACATGAACATGTTTGATGAGCAGGAGAGTCTACACGCCACGCG
TGAAGACTATACCCATCTGAGTGACATCGAATGGAGTGCGGTAGGATGTATGAGATCTACCGTAGGAGAAACCGCCATTAGCGCCATGTTGGAGTCTCTT
GACAGAGACCAACAACATGCCGCTATAGCCAGGTTCATTTAAAATGAGCTTGTCTCCGAAAGAGATAAAGTAGCCTTGCTTCACCAGCAAGGCTCTCAAC
AGTCCGAGCAGTTGAGAGAACTCAGTGCTCAACAGACAGAGCTGTTGAGACAGCAGCAATTCAATGCTGCTGTGGGCGGGACGACACACAGGCGTCGTCC
CAAAATCTTGAAGGTTTATATCTCCAAGTACAGAGGAGTCGAGGAAGAATCCATGTTGTTATGGTTCGTCTAACTAGACAGAGCCATAAAGGCACGGCGT
ATCGACGATGAGCAAATGAAACTAACATTTGCTCAAACCCACTTGGCTGGACGTGCCAAGACTTGGGCCTTAGGGCTGGAGATGAGTGACCCATATGCTT
TTGGGTCGCTAAAAGCCTTTAAAACCCGGCTCAAACAGACGTTTGAGCCACCACGAGCTGAGTTCAGGGCTCGGTCAGAGCTTCTGAAACTCAAGCAGGG
TAAGCATGATGTGCACGCTTACGCTCAACATATACGACTCCTCGCGAGTAGTATAATTGCTAACCCAGTCCATGAGCACACATTGATTACTGTGTTCGTG
CAAGGGCTCGCAGTGGGCCCGTCAGGAACCATCTGTTCCGCTTAGAGTTGGATACGCTTGAACAAGAAATCTCAGCTGCGAAACAGGAGGACTTTAGCAT
GAGACAGGCTCATGCTAGCTTGAGCTCTTATCGTCCACCGAGACTACGAGATACTGGAGGTCCAGAACCAATGGACTTCTGTTATGTTGAGAGCGAGAGA
CCTCGCTCTTCAAACAACAAGCGATTGCAGAAGTGTAACCGCTGCCAGAAGTTGGGACACTACGCTTACGAGTGTAGTGTCCCACGCCCAGTACCAAACA
ATACTGAGCGGAATGATTGGCTATTTGCCAAGAAGGGAAATGGGCGTAGGTCCAACGCTGTTGCGAAACTGCAATAGCGAAGCGGACCATCAAAAAATGG
TCGGGATCAGTAGGGGCGGAGCGCCCTACTGATCCAGCAACCTCAAGAGAATTTGCAAATCTCTTGACGAAAGTTGCTCCAGATACACAATCATTGTGTG
TCTCTGCACCTGGTGATGAGATATCACTCATCACTTCGAAGTTGCAAGTGACAAATGATTTGTCACTTCGTACTCTAGTCGACTGTGGGGCGTCGAACAG
CTTTGTTAGTCGTCAGTCGCTAAAGGATCGTAGGCTTAAGTTCGTTGAGCGCGACATCTATCAAACGATGATGACGGTGTGCCTTGCCACAGGCGCGTCG
ATAAACGTTGAAAAACGTGTAGTTGGAATCCACTACACGTTAGAGGGTGAACAGTACGATTATGATTTCATCGTACTTGATTTGAATGACAAATTTGATG
TCATCCTGGGATTACCTTGGC