Description :
From Genome Similarity Track
Location :
Scaffold_86:85694- 90807
Transcript NameFunction/comments
Hyaar_Emoy2808707nucleic acid-binding protein
Hyaar_Emoy2808708hypothetical protein
Hyaar_Emoy2808709ATP-binding Cassette (ABC) Superfamily

Sequence
5113 bases(100 bases per row)
TTAAACTAACGCTATTTCGTCCTCTATTTCTCTCCTTATTTCTGTCCCTATTTCTATTGTTTGATTCTACCAGTTTGGACCTCTTGAGCAATGTGCTGTC
AAAAAAGGCTACGCCTTTGTCCATTATGAACGGCTCGAGGATGCAGAAATGGCAGTCCAAGAGATGAATGACAAGGAATTGGGTGGTCGTCGACTGCGTG
TGGCTTTTGCCGTGTCGCACGGCATGCAACGACGCTATGACGGACCGCCGCCGCCTCTGCATGCAGTGCCCCCAGGTCCACCACCAATTATGCAGCAGCT
GGACCCGATCCGGCCGTCGCCGCTACTGCACAACCCCCCGTTTCCAGTGAATGCGTCGCCCAATCTGTTTGTCGCCAATATCCCGCCTCACGTCAAGATG
AGTGAGCTGGACGACGCGTTTGCTCGATTTGGAGAAGTCAAGAACGTTAAAGTACTGCCGCAGTCAAGACCGGACGCGCCCATGTCTGCTTTTGTCGACT
ACACTGACGTGTCGTCCGCGCAGAAGGCACACAGTTCCACGATCGTCATATCGGGACAGCAGCTCCGCACGGACTATAATTTCCGCAAGTACGTAGAATG
AGAGTTGCTAGATGACGAGCTGACTACAAAGCTAATGGCGGTTTGTGCTTAATGATCTGTGTAGAAGCAAAGGGGACGGACCGAAACGCGTAGTAGGTAA
AAGCCCTGACGGTGGCTATGATGGTGAAGAGCAGAAAGGCAGGCGTCCGCGCTACGACTCGATCGACTCTCAATTTGGCAAACGGAGCAAGTTTGAAGAC
GAGACGGAGGATCCGAGCCATCGTCGTCATCATCACCATCGCCACTCGAGTCGTCACCATTCGTCGCGCCATAGTCGAGAGGACCCGGACGAGCGGGAAC
GCAGTGCATCTCCTTTGCCTTATCGTCATCATAGCAGCAGCAGAAGCTTGTGTAGAGGTGAGGATTCTCTGAGGCGCGAGCGTTCGCGGGTCCATCCGCC
TTACGTACGTCCAAATGACCCTGACAAAATCCATCAGCATGCACGCCGTTCGCATCACGGCGAGTATAACGATCGCCGACCACGGGGCGAAGAGAGAGTG
GCTCATGAGTATGCAGAACATGAACTAAACAAGTTGCCGCCGCAAGAACTTCGTCGTCACAGCCGCCCGGAGATATCGCTGCGTCACGGATCGCGCCGCA
GTCATCGAAATGATCGGAGCTGGTACGACCAATGCGTCTGTTGATGATACCTCTATTTTCTTACTCAATTGTTGCAATTATTGCTGGATTTGTTTGGTGT
ATAGGTCGCCCTCTCATTCGAGACCTCGCAGTCGTAGCCGCTAAGGTGTGCAACGCTACAAGACATTGGCGCAGCTACGTAGTGAGTCTTCTACACCGGA
CAAAGACAAAAGGAGACTGTCGGAGTCTCGTAATTTGTCGTGGATTCGCGAAGAAAGCTGGGGGAATTAGCAGCTTGGTTGTATCTCGAAAGAAATGGAT
TACATCATCTGTGGTTGTACCGTTAACCGTATGCGCTGGGTGGCGGGCGTTTGTTCCGTTAGTTCTCGTCGTTAGTGGATGGATTGTTCGATGGTCTCCT
TGGTATACAGACTGCGTTCTACCACCACGCAGCGGGTCGCTTGGCGATGTGATTGGAATGCAGTGGTGTGTATATATGAATTTAGAAATGTGGTGGTTCT
TTTCGCCTGGACTATTTGGTTGACGGAGGTATACGGGTCCTTGAATGATTGGAATCAGATTAACAGGCACCGTGTAGTTCTACTGATATCCATGCGGAGC
CTTCCATGACATCACGAGTCTCACGATGCAACGCATAACGCTGGATTGCTTAGCATATGGACGCAGTCTACACGACTTGACTATTGCACGTTTGTCGGCC
ACAGTGCTTGTAGTCCATGCGATGGTGGAAAGAAAGTCGGCCATTTCTTAGGTATGTGATGCTTGTGTCTGCCTGACTTTTGCGTCGTGGAGGTACCTGC
CACCTCCAGTGCACTACGTAACGACCGATTTACATGATCTTGCGTGCGTGAGATCGATTGAAACTGACGCTCATATTCCATGCCCGAAGTAAGTTGGACA
ATTCACTTTCTTGTGTCCACGCGAACAAGTCACGAAAAGTTTTCTGTCGTCACACTAGGACTCCTGCTCCCTGTTGCCAGTGTGGATGTTAATTTGTTGG
TCATCTCCCGAAGCATAGACGGCGCTTTAAATTTGTATCCTTGGTGCCGTCTATAAGGGGATGAGAGCTTGGTGTTTGCGCCAAGGTTCTGCTGCACTAA
ACAGCCTCGTCAAGCTAATATTTTTATGTGTATATCCATGCATTGGATCGAGTGCTCAAGCATCAATCCACTCCGCTAGAGCTCGATATGTCGTGTCTTT
GTTGGAGCTGTAGCACAGAGCCATACCGTCCTTCTCTAGATCTTATCGAATCAACAAGAGATTATGCACCACGCTTTTCGGGGACTTTTTACAACTTCAG
TATCGCATTCGTAGCTCCAGATAAGATGTGATGTCCAGCGATCACTTGCGCTCGTGACTTATGTGATCCAGACTTTATGAAAGGTCGTCGAAGTGGATTG
ATCATTATCTCTCAAACTATTAAAGCGATCACAATATATATGGGTCAAGGCAAACAATGTAACCTTCGAGCTCACGCTCGCCGAAGGCCCTCCTGTACGG
CAGCGCGTGCACGACAACCACATGCTGTGTATGTACTTTGAGTCCCAGCCACAAGCTTGTCCTCTGCGCGATAAAGTGAGCGCCTGTAACTGCAATCGGG
GATGTACGAGATGATCAAGATACAGTGCTTGAGGTTTACTCGAACAATGGCTTGGCATTTACATTGATGGAAGACAATCTACTCCGACACTAGACGTCGT
TTGCAGCTCTATCATTCCGGAGCGGCGACCACTCCAGGTCCTTGTAATTGCTCAGCTCTTCGATCGCACCGATGTGTATCACTGCGACCACAGCTGCTTC
CGGATCGCCAATAAGCAGTGGGCCAATATGTTTCGATGCTGTCACGATGCCTGCAAGACGTGTTTGTTCTCGCTGTCCAGTGTGCCATCGCCCCGAAGCA
GGGCGCTCGGTCGCACAAGTGTGATGCACTACATGAAACCAACACACCACGAGCGTCCACTATGTAATAACCCGTGTGGGATATCTGGATGACTGCGGAT
ATCGACTCTCTTTGCCGTCGCCTCCTCTTGACACGCCACCGATTTGCACAGTGCAACTATCTCTACAGTAGATACCGAGAGCAGCACCGTTTGACAAGTA
AACTGCGACGACAGCCTCACTGAGCGAGCTGCTGGTAATGACAGTACCGAGTTGTCTGGACAACACGATTGCAGCAGTCTACACGGCGTCGATTCCAGTA
CGTGGCTGTTTTCTCGATCTTTTCAAAGTACAAATGTTACTACCGACATAGTCAGGATACCGTCTCACTTGTTACACATGTCGACAAAAGATACGCTGCC
TCGTCCCGTATTCAAAGTGAGGCAACAATGCAAATCACATCAATAATGATTGAACAGAACACGCCTAACAAGCAGCATCGCCGTCATCGTCGTCCAATGC
GTTCATCCATTTCGTCACCGAAATCGCATGCTCTTACCACGAACGGCAACCCAACATGACAAATAAAGACCCCGAAAAACAATAATAACACCAGGAATCC
TAACCAAGAACAAAGCTACGTGATCACTATAAGTCGTTCCGACCCCTACCACAACCAGCTCATTCATTCCATCCACCTCACCCCGAAACCGCACCATTTC
CACCCTCTTCGTCATCCTTTCCACCCTCACTATTCAAAACGCCGCCTCACTCTCATTTCCAAACGTCATGCAAGCGTCCCCCGTGCTCCTCCTCCTCCTC
ACTCTCCTCCATCTCCCCCCACAGACGCCTCTTTCCGCCCCCCTCGTGCCACCCAATACAAACTCATGCGACCCCCACTACGAGCACCGCAATGCCACCA
CCGGTTGCTGCGACTGTCGCGAGGGTTTCCACGGCCTCAACTGCCGCATGTGCACGCCGTCGAGCTCTTCATCCTCATTATTACCCGACAGTTGTCAGGC
GTCGTTTGGCCCGGACTTTTCGTGCGTCACGGGCCTCGTCTACGACGCCCACGCGTCGCTCAAGACGTACGACTGTGTCCTGGCCTCGAACCTCCAAGCG
CTCGTTCCGGACGGCGCGTTGGCCGTTCAGTGCCACCGGAACGAGCACCTCGTGGCCAATTGCTCGGCAGCTGTGTACAGCGCCAAAGCCTCCGAGGTCC
AGAGCGAGCACGTGATTGACTGCCACTTGACGCAGTGCACGTTCGAAACGGGGGCGGCAAGTGGCGCCTGTAAAGAGATCCGCTGCAAGTGCGGCCCCCA
GTGCTCGGCCATGACGAGGGCGATCGTGGAGCACGTGCTGAGTGGCAAAAGAGCGGCTATTGACGTGACCAATGGCACGCACTTGGCCATTGATGTCGAG
GGGTCGCCGATTCCATTGGCAGCCACGTGTGAAGCATCGGCTTGTGAACGTGGATCCAGTGCAAGTGGCAGTAGCAGTGGCAGTGGAAGTGCTTCAGGAG
GTACTAACGGTTGGAGACACTGGAGTTGGACTGTCCTTGCTGCAGCTTTGATGGTCGTGGGGCTTTTGGGGGTACTGTGGCTAAGTTCGTGCTGGAAGTA
TACGGGGTTGGACTGCCGAACGACGCGAAAACGACAGAAGGAGGTGGAGAAGGGACTTGGTGGGTATCACTTTGTGCGTACTCTGGAGTTCCGTCACATT
AGCTGCTCTGCTGATAGTGGACGACAGTTGTCGGGGGCGTGCAAACCCATTTTGCACGAGATTTCGGGGAACGTCTCGCACGGTCAAGTGCTTGGTCTAT
TGGGACCGAGTGGCTCGGGCAAAACGACGTTATTGAATGCACTGGCAGTCGTGGACAATGGGCAGTGTCAGGTGACGGGGGACTTGCTGCTGGATGGCAA
GCAAGTGTCAAGCAGCTACCGTCGCATCGCTGCCTATGTACAGCAGGATGATTCACTCTACTCGACGCTAACTGTACGTGAATGTATTTCGTACTCGTCA
CAGCTTCGTCTCT