Description :
From Genome Similarity Track
Location :
Scaffold_2:85691- 87198
Transcript NameFunction/comments
Aphas_H257_00958CAAX prenyl protease 1 putative

Sequence
1507 bases(100 bases per row)
AAGCGCTCGACGAGCGGCGGGTGGCTGTAGTGGTAGGCGCTGTACAAAGTATCGGGGTTCATATTGGCCAAGTTTTCCAGCGAGATTTTGGTCAGCGCCG
ACTGCAGCGGTTCGCCATGGCCCAAATCCACAGCGAACGCATCAGCTTGGAACTCGTTGGCGCGGGTGTTGGCGGTGACGACGTACTGGAGCAGCTTGTC
CACGGGTGCCCACACGGTGGACGTGAACAGCGTGAGGCTGATGACAACCGGAAGGTCCACGGATTGCGAATCAAAGCCAAAGCTGGCAAACAAGTCGCGG
TCGTGCATGCATCTACCACACACTTATATAATCGACAAACCGCCGTAATGACGCGATTGTACGATCAAACCTGGCAAACACGGCAAACATGGCGCCAATG
TACACTTGCTGGACGACGAGATTCTGCACCGTGTGCCACAGCTTCCAGTGGCCGAGTTCGTGGCCCACGACAGCCACGACCTCGGCGTTGCTGGCTTGGG
TGAGCAACGTGTCGAACAACACAATGCGCTTGTTGTTGAAGAACCCAAACAAGTACGCGTTGCTGTGACTTGACCGCTTGGACCCGTCGCACACAAAGAG
TTTGGTCAGAGGGAAAGCAACGGACGCTGCCAGCGCTTCGATTGCGTCTCTTAGCGAGCCCGACTCTAACGAGTTGAACGAGTTGAACAGCGGCATGATC
CACGTCGGCACGATCGTCATCAAGATCAGCGTCACCACAAACGTAAACGTCCACACGTACACGACAAAGAGGTCGCCGCCCCATCGGACGATCCACAGCA
CCGCCGACAGCACAGGGAACCCGATCGCGACAGTCAGCAGCGTGCTCTTGACCTTGTCCAGAAAAAACAGCCCGAGGGACTGCTTGTTGAACCCGTGACG
CTCCTCCACCACAAACGTAGCGTACAGGTCGAACGGAAGACTGAGAAGCATGTCCCGCGCTGCCGTGAGCGTCACAAACACAAGCGACAAGGGGATTTCG
TTGGCCATGGGGTCGTAATAGCCCCAAGACGCGAGGACACGGCGGCTAGTTTGCCACATGAACGGCATGTACCCGAGCAAGAGCATGGCGAGTCCGTCGA
CGAAGTGGAAGGAGTCGTGGACGAACTTGAACGTACTCTTGTCGAGGCTGTACAGGCGACTAGTTTCAAACTTGGCGGTAGTTTGCGCCAACAGCGACGA
CTTGTTGCTGTCGTGGTCATTGTTGTCGTCTTGGACGTGATCGTTGTTGGGTTTGGCCTGGTTTTGCTCGTCGACATGGCGAATCGCACGGCTCAACTTG
TCCGGCAACGTTGTCTCGTGCAGTTTCTTGTGTTGGCTAACAAGCAAACCATGTTACGATGGGATGAAAGGGCAGAGAAGAGAAGTGTGTCGGTCGTACC
GGTAGTCCAAGTAAGTCTCGAACACATGAACGATACACACGAATGCGAGGGTTCCTTCCAGATATGGCACCGCCGACATGCGCCACCCTTCGTCTGTGAA
CCACGGC