Description :
From Genome Similarity Track
Location :
Scaffold_217:85653- 90297
Sequence
4644 bases(100 bases per row)
GAAAAGAAGGGAAGAATCTCCTCCTGTGGATCACAGAGGTGGGAATGGCTATGAAATAATGCTATGCTCCAGTCGGAGCAACAGCGAGTTGGGATGGCTA
TCTCAGAACGGGATGGTAGAGCCAGAGAATGGGCTCTCACGTGTAACACGTCGGTAGACGAAGCTTTCCCCACATGAGATTTGCTAAAACAGCAAATATC
CCGGGTGTGTGCTCCGCCTAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCCGTCAGGGCAAGAAAAAACTATCGGACTATGTCCAGGAACTG
AGAACTCTAATCGCTGCCATGCAGCTTGATCCCTTACCAGAAACGGTTTGGTTACCATCTTCATGTAGGGCCTTCGTACGGGCGTGGCTCGAACGGAAGT
ATTCCGGGTACACCCCACTTCCTTTGAGGCGGCTGTGGATATCGCGTTGAACTCTGAGTTCAACTTGACGGCAGCCCGTTTTGGCACCCATGGGTAAAAC
CCAAACTCGACGAACTCCTTTTCGTTCATTCAATAGGCCGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTGTAGAA
CAGCATCGAAACATTCGACGATGTTTCACGTGCGGAAGCACAACGCATCTACGCCCTAATTGCCCTTACGCAGGGCACTCCAGGCTACTTCAGGCCAAAA
TCCCGCCGCTAACCAGAAGTCTGGTACGGTGCGGGAAAACATAGACTCCCAGTAGGCGCGGGCGCCCTGCTGGGGAAGAACTAGGTTTTGTTGAGCCTCT
AGTAGGTAGTGGCGAGCAGAATTTAGCCCCAAGGAGTCCTGTGCACTCTAACACGGGACGTAAATAGAATCCCGGCTTGTTGGTCGCAAAGGCGACTGTT
AAAAGCTTTGACAAACCCTGGTCGATTTTGATCGACTCCGGAGCATCCGTAGTTATATCAGAAGATGTTCCCTTGAAGGGAATCCACGTTAAGTTGAGGC
GCTAAAAGCGCACAAGGGTGATATGATCACTGTTCGCATGGAAACAGGAACTCTAGTCACTGCACCTAAAGTTCCTGTGAACTTGGGTGTGAAGTTTTCA
ATTTTGATAGAATCGAACGCTGTTTAGTCCTTGATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGAGCCATGATTGAC
TGGAGGTCGAAAACATTAGGCGCCACGCACACTGCCCCCAGCGGAGCTTTGGAGAGTCATGAACCCACCTCTGCTAGGAATAAGAAGCGTTATTGGCGCT
AGCCACTGGCTGACAATGTCAGTGTGCTGGACATTGGAATGTTAGAGTTAGTTTATTCTGATGATGTCAAAGACATGAGTACATAGCAAATCTCGATATG
TGATAGTGAAGCGGCGCGTACTCCGGTAAGTGATAGTCGTTGTGAGAGCAACGTACTGAATGCTCAAAGCATTGTTGACCAAGCGTCAAATCATCGAGGT
TTGAACCATCAGATGAGCGTGGAGTGGCACGTAATCCACGTGATGACGACGTCATGTCCAATGACTCGTCATAAGATGTCAAAGTAACGTCAACTCTGGT
TTAGAGCAAATTACGGTTGATGATGGTATCGATCGGATAGATACGAATCACACATCGTGTGCTGCGTCACAAAGTGATGATGACTGTCAGCTGTATATAC
TCGTCAACGGAGTGACTGGTGACTGTGATGGTACAATTAGCCTTGAGGCTATACTCTCGTTAATTCTCTTTTAGAACTCGAAGAGTTGTCCGTCGATAAG
TTTGATCACTCACTAATAAATGGAGACCTTTCAGAGGTGGTGATCATTCGACCCGACATCATAGATTTGAACTCTTCTTCACTTTTGGATGAAGCCGTTC
TGGAGGACACAAAAGCAGCACTCAGTGCGCGTAGTGGGTCATCAATATGAAGGTATTGAAATACCTTCATGATCCCTTTTATTCCTTAGTCAAAGAATTT
CAAGATCTGGGTGTGCCACGATCCACCCTCTGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACGAAATACTGTATTACA
CGACAGTGGACCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTCTACCGTTCTAAGCACGAGGCGGGAATGGTACGTGAGAGTAAATCTCGACATT
CGACACCGACATTTTGTGTCAAAAAGCCGAACGGCAAGTGGCGTATTGTGCATGCTTATAACAAGCTTAATACTGCTACGATTCCGGCACAGACACCCAT
TCCTCGAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATATCGCACTCGACTTGGTCGATGGATATTATCAATTACTCATGCGAGCGAGT
GATATTCCACTTACAGCAGTGAGCACACCAAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATACTCTGGCAACATTTACGTCTG
GTGACGCAACTTTTCCGCCCACATCGGGATTACTCACAGACGTACTTCGATGACATTTTTGTCCATAGTCGCGCCGAACAAGGTCGGTCAGATGTTGACA
ACCAGATCGATCATTTACGAGCCGTGCTAAATGCATTTTTGGTGCAGAGGAGATTCCTTTTCTAGGATGTTTCATTGGTAAACGCGTCCTTAGAGAGGAT
CCCGCTAAGGTCAAGACTATTGTGGACTGGCCGATTCCTAAGAATCAAAACAACTTGCTCAAGTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTG
AAAATTACGCTGATATGGCTCGACCATTAACTGATATCCTTAAGAAGGATACAGATTGGCGCTGGGACAACACCCATGCTGACGCGTTTTGGGCTATCAA
GGAGAGTCTCCTCCATGCTCCCATTTTGGCGCTGCCAAATCCTGAGTACCATTTTAGTGTTGTCTGCGATGCATCCGATTTTTCTATAGGCAGCTGTTAC
AAACAGATGCTGCAGGTCGCGAGCGAGTTATCGCATTTGAATCTCGTCAGCTGAAAGCTTCTGAAAAGAACTGTCCATTTCAAGGCAAAGAGCTACTTTT
TATGTAGTATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGCTCCAAGCCATTCGTCTTCTATACGGATCATGCGTCATTACGCGCGGCGATACAGTAG
CCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATATAACTTCGAGGTGAAGTATGAGCCTGGCAAACAAAATGTGTTGGCAGATG
CCCTTTCTCGCAGACCTGATTATGAGCTTAATCATGTCACGGCTGTGTCGTCTCCTATTGAGGAGTTAACTTTTGTGGCATACCCACGGGATTATCAGTG
TGTGGCATTGTTTTATGCCCTTGGGAGTGAGGAATACAAGGACTTGGACAGTCAATTATCAGCACGCTTGCGGGACAGCCTACATCGATATTACATCGAT
AATGGTATCTTGTGCTATCGCACAGATGTAGCGGATACAGCCCGAATAGTTGTGCCTCACAATGAGGATTTAGAGTATCAAATCCTCTTTAAGGCCCACG
ATACTACCCTCAGTGGGCATTTGGACCGGGAAAAGACTTATGGCTCTGTGAGTCAACACTAATTGTGGCTCAAACTCTACAAATGGGTTAGCACATACGT
GCTTACATGCGAAAAGTGACAGAGGGTCAAACCCTCAGCACACTCGGCTGCGCCACTCGCCTGTTTACCTGTGCCCAAGGGGTGTTGGGAGTCCATCAGT
ATGGATTTTGTGTTTGGTCTTCCCAAAGGCTGTGACGGCAATACGGGTATTGTGGTATTTGTGGACCGTTTAAGCAAGATGGATCACTTGGTGACGGTGC
CAGATTCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTTGTCAACACGGGTTGCCGCTAGCAATCATCTTCGATCATGACCCTCG
CTTCACAGGCAAGTTTTGAACTTCCGTCTTCAAGGTGCTTGGCACGCGATTGGACATGTCCACAGCGGATCATCCGCAGATCGATGGTCAGACTGAGCGA
GTTAATCGCGTCTTTGGTGACGTTCTTCGCAGTGTTTGTGCTGAGTCTCCTAAGACTTGGAACTCGATGATCCCTGTCATTGAGTTTGCGTTGAACAACG
CTGTTCATGACTCGACCGGCTTTACTCCCTTCTATGTGAATAGTCTCACGCACCGTCGCTTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTGGTGG
GGAAGAGTCTGCTGACAAGCATGCTAAAATCAGCCCCATCACGATGCAGAAACAAGTGAGCGAGTTTCTCGCGACGCGCTTTAGTGTCTTACGACATGTG
CGTGATGCAATGGCTGATAGCCAAGACAAACAAAAAGAAAAAGCTGATGCTAAAGGCAGAGGATGTATTGATTATTATGAAGTTGGAGACCAAGTCTTAT
TAAACACTAAAAACCTACCTACAAATGTAGTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGGCCGTTTACGGTCATAGCGAAGAAAGG
CATTGCCTATACACTCAATCTCCCGCGCAAGTTGCGCACACACC