Description :
From Genome Similarity Track
Location :
Scaffold_217:85649- 90277
Sequence
4628 bases(100 bases per row)
GAGGGAAAAGAAGGGAAGAATCTCCTCCTGTGGATCACAGAGGTGGGAATGGCTATGAAATAATGCTATGCTCCAGTCGGAGCAACAGCGAGTTGGGATG
GCTATCTCAGAACGGGATGGTAGAGCCAGAGAATGGGCTCTCACGTGTAACACGTCGGTAGACGAAGCTTTCCCCACATGAGATTTGCTAAAACAGCAAA
TATCCCGGGTGTGTGCTCCGCCTAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCCGTCAGGGCAAGAAAAAACTATCGGACTATGTCCAGGA
ACTGAGAACTCTAATCGCTGCCATGCAGCTTGATCCCTTACCAGAAACGGTTTGGTTACCATCTTCATGTAGGGCCTTCGTACGGGCGTGGCTCGAACGG
AAGTATTCCGGGTACACCCCACTTCCTTTGAGGCGGCTGTGGATATCGCGTTGAACTCTGAGTTCAACTTGACGGCAGCCCGTTTTGGCACCCATGGGTA
AAACCCAAACTCGACGAACTCCTTTTCGTTCATTCAATAGGCCGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCGAGCTGT
AGAACAGCATCGAAACATTCGACGATGTTTCACGTGCGGAAGCACAACGCATCTACGCCCTAATTGCCCTTACGCAGGGCACTCCAGGCTACTTCAGGCC
AAAATCCCGCCGCTAACCAGAAGTCTGGTACGGTGCGGGAAAACATAGACTCCCAGTAGGCGCGGGCGCCCTGCTGGGGAAGAACTAGGTTTTGTTGAGC
CTCTAGTAGGTAGTGGCGAGCAGAATTTAGCCCCAAGGAGTCCTGTGCACTCTAACACGGGACGTAAATAGAATCCCGGCTTGTTGGTCGCAAAGGCGAC
TGTTAAAAGCTTTGACAAACCCTGGTCGATTTTGATCGACTCCGGAGCATCCGTAGTTATATCAGAAGATGTTCCCTTGAAGGGAATCCACGTTAAGTTG
AGGCGCTAAAAGCGCACAAGGGTGATATGATCACTGTTCGCATGGAAACAGGAACTCTAGTCACTGCACCTAAAGTTCCTGTGAACTTGGGTGTGAAGTT
TTCAATTTTGATAGAATCGAACGCTGTTTAGTCCTTGATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTTGAGCGCCATGAGCCATGAT
TGACTGGAGGTCGAAAACATTAGGCGCCACGCACACTGCCCCCAGCGGAGCTTTGGAGAGTCATGAACCCACCTCTGCTAGGAATAAGAAGCGTTATTGG
CGCTAGCCACTGGCTGACAATGTCAGTGTGCTGGACATTGGAATGTTAGAGTTAGTTTATTCTGATGATGTCAAAGACATGAGTACATAGCAAATCTCGA
TATGTGATAGTGAAGCGGCGCGTACTCCGGTAAGTGATAGTCGTTGTGAGAGCAACGTACTGAATGCTCAAAGCATTGTTGACCAAGCGTCAAATCATCG
AGGTTTGAACCATCAGATGAGCGTGGAGTGGCACGTAATCCACGTGATGACGACGTCATGTCCAATGACTCGTCATAAGATGTCAAAGTAACGTCAACTC
TGGTTTAGAGCAAATTACGGTTGATGATGGTATCGATCGGATAGATACGAATCACACATCGTGTGCTGCGTCACAAAGTGATGATGACTGTCAGCTGTAT
ATACTCGTCAACGGAGTGACTGGTGACTGTGATGGTACAATTAGCCTTGAGGCTATACTCTCGTTAATTCTCTTTTAGAACTCGAAGAGTTGTCCGTCGA
TAAGTTTGATCACTCACTAATAAATGGAGACCTTTCAGAGGTGGTGATCATTCGACCCGACATCATAGATTTGAACTCTTCTTCACTTTTGGATGAAGCC
GTTCTGGAGGACACAAAAGCAGCACTCAGTGCGCGTAGTGGGTCATCAATATGAAGGTATTGAAATACCTTCATGATCCCTTTTATTCCTTAGTCAAAGA
ATTTCAAGATCTGGGTGTGCCACGATCCACCCTCTGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACGAAATACTGTAT
TACACGACAGTGGACCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTCTACCGTTCTAAGCACGAGGCGGGAATGGTACGTGAGAGTAAATCTCGA
CATTCGACACCGACATTTTGTGTCAAAAAGCCGAACGGCAAGTGGCGTATTGTGCATGCTTATAACAAGCTTAATACTGCTACGATTCCGGCACAGACAC
CCATTCCTCGAAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATATCGCACTCGACTTGGTCGATGGATATTATCAATTACTCATGCGAGC
GAGTGATATTCCACTTACAGCAGTGAGCACACCAAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATACTCTGGCAACATTTACG
TCTGGTGACGCAACTTTTCCGCCCACATCGGGATTACTCACAGACGTACTTCGATGACATTTTTGTCCATAGTCGCGCCGAACAAGGTCGGTCAGATGTT
GACAACCAGATCGATCATTTACGAGCCGTGCTAAATGCATTTTTGGTGCAGAGGAGATTCCTTTTCTAGGATGTTTCATTGGTAAACGCGTCCTTAGAGA
GGATCCCGCTAAGGTCAAGACTATTGTGGACTGGCCGATTCCTAAGAATCAAAACAACTTGCTCAAGTGGCTTGGCCTTGCCAATTACTTACACAAATAC
AGTGAAAATTACGCTGATATGGCTCGACCATTAACTGATATCCTTAAGAAGGATACAGATTGGCGCTGGGACAACACCCATGCTGACGCGTTTTGGGCTA
TCAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGCTGCCAAATCCTGAGTACCATTTTAGTGTTGTCTGCGATGCATCCGATTTTTCTATAGGCAGCTG
TTACAAACAGATGCTGCAGGTCGCGAGCGAGTTATCGCATTTGAATCTCGTCAGCTGAAAGCTTCTGAAAAGAACTGTCCATTTCAAGGCAAAGAGCTAC
TTTTTATGTAGTATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGCTCCAAGCCATTCGTCTTCTATACGGATCATGCGTCATTACGCGCGGCGATACA
GTAGCCTCACCTCTCTCAGAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATATAACTTCGAGGTGAAGTATGAGCCTGGCAAACAAAATGTGTTGGCA
GATGCCCTTTCTCGCAGACCTGATTATGAGCTTAATCATGTCACGGCTGTGTCGTCTCCTATTGAGGAGTTAACTTTTGTGGCATACCCACGGGATTATC
AGTGTGTGGCATTGTTTTATGCCCTTGGGAGTGAGGAATACAAGGACTTGGACAGTCAATTATCAGCACGCTTGCGGGACAGCCTACATCGATATTACAT
CGATAATGGTATCTTGTGCTATCGCACAGATGTAGCGGATACAGCCCGAATAGTTGTGCCTCACAATGAGGATTTAGAGTATCAAATCCTCTTTAAGGCC
CACGATACTACCCTCAGTGGGCATTTGGACCGGGAAAAGACTTATGGCTCTGTGAGTCAACACTAATTGTGGCTCAAACTCTACAAATGGGTTAGCACAT
ACGTGCTTACATGCGAAAAGTGACAGAGGGTCAAACCCTCAGCACACTCGGCTGCGCCACTCGCCTGTTTACCTGTGCCCAAGGGGTGTTGGGAGTCCAT
CAGTATGGATTTTGTGTTTGGTCTTCCCAAAGGCTGTGACGGCAATACGGGTATTGTGGTATTTGTGGACCGTTTAAGCAAGATGGATCACTTGGTGACG
GTGCCAGATTCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTTGTCAACACGGGTTGCCGCTAGCAATCATCTTCGATCATGACC
CTCGCTTCACAGGCAAGTTTTGAACTTCCGTCTTCAAGGTGCTTGGCACGCGATTGGACATGTCCACAGCGGATCATCCGCAGATCGATGGTCAGACTGA
GCGAGTTAATCGCGTCTTTGGTGACGTTCTTCGCAGTGTTTGTGCTGAGTCTCCTAAGACTTGGAACTCGATGATCCCTGTCATTGAGTTTGCGTTGAAC
AACGCTGTTCATGACTCGACCGGCTTTACTCCCTTCTATGTGAATAGTCTCACGCACCGTCGCTTTCCGCTCACGTTACCACTACGTGGTTCTGGGCTTG
GTGGGGAAGAGTCTGCTGACAAGCATGCTAAAATCAGCCCCATCACGATGCAGAAACAAGTGAGCGAGTTTCTCGCGACGCGCTTTAGTGTCTTACGACA
TGTGCGTGATGCAATGGCTGATAGCCAAGACAAACAAAAAGAAAAAGCTGATGCTAAAGGCAGAGGATGTATTGATTATTATGAAGTTGGAGACCAAGTC
TTATTAAACACTAAAAACCTACCTACAAATGTAGTGTCTGCCGTCTTCAAGACGAAATTGCGTCCGCGCTTCATTGGGCCGTTTACGGTCATAGCGAAGA
AAGGCATTGCCTATACACTCAATCTCCC