Description :
From Genome Similarity Track
Location :
Scaffold_348:8563- 11705
Transcript NameFunction/comments
Phyke_g9055Amino Acid/Auxin Permease (AAAP) Family
Phyke_g9056Amino Acid/Auxin Permease (AAAP) Family

Sequence
3142 bases(100 bases per row)
CCACGATGCCATTCTTCACCGCAGAGGACGCTAAAGTGTCTTTCAATCTCTTCTGCTGTATGTACGGCATCGGCACTTTGGGAATGCCCGGCAATTTTTC
TCGTGCCGGTCCCGTACTTGCCGTTGTCGCTAtggccttcatggccttcgcCAATATCTATGCGTCCGTTAAGCTGTCGCAAGTGATGCTGCTCGCTCCC
AAATCTGTCAAGACTTTTGGGGACCTGGGTGAATGGAGTATGGGTAAGTGGGGCCGCTGGCTCAGCGTTGTCTCCCAAATGGGCTCCTGTCTGCTGATCC
CGTGTGTATTCCTAATTCTCGGCGGATCTCTGTTGGATGGCCTCTTTCCTGACGCTTTCAGTGCTACTGTGTGGATCATCCTCATGGCACTGACAGTGCT
GCCTGTCTGTCTCGTCCCGACGCTCAAGGAAGGAGCTGGGGCTGCGTTCGCCGGTTGCCTTAGCACCATCCTCGCTGATGTGATTGGGGTCGCTGTCGTC
ATGTACGGCATGAGAGGCCACCCGTCTATTCCGTCGCCTGATATTAAGTTCTCCCAAGTTGCAGGCTGTTTCGGGAATTTGGCGTTGGCGTATGGTGCTG
GTATCGTTCTTCcggatctgcagcgtcaacatAGCGACCCGACACGGATGACTCGAGTTATCCTTGTTACGCTCACTGTCAACACGTGTATGTTCCTAAC
ACTAGCGAGTACGGCGTACTCGTCGGTGGGCTGCCAGATCTCAGGCAACTTGCTGTTTACGATATACCCGGACGAGACGACAGGCCTCACTACTTTGGGA
TTCAAACCGAACTGGGGCATGGTTGTGTTGGCGTATTTGTTCATGCAGCTGCACATCACAATCGCGTTCTCCGTCATCCTGAATCCAGCCTTCTTTCTCG
CCGAGCGTTTGTTTTTAGGGATGCACAAGAAACAAACGACCGACATTGAAATTGGTCGTAACTACGTGGAATCTGAGACGCCCTCAGTTGTTCAGTCAGA
ACCTCACCGCAGCTCCAAGTTATCTTATGTTTCAGTGGCTGATAGTGAAAGGGTCTTCAAAGATGACCTGGAGGCGGAAGCGGCCGAGTACCGTGGAGGA
CCCAACACCATCAAGTACGTTTCGCTTCgcattgtcatcatcgtcgccttGGTCGTGGTAGCCGTCGTTTTCCAGGACCACTTTTCAGATTTTGCAGACT
TTGTGGCAGGGTCCTGCATCACTTTGAACTGCATCCTGCTGCCAATCATATATTACCTCATGAAGGAGTGGATGGAAGTCCCCATGTATGAGAAGGTCGC
CGCTACTATTGTGCTTGTTGTTTGCTTCGCGCTTGGCTGCTACGTGACGTACACAACGGGCAAAAACCTATTCGCGCCATCAGACAGTGACACAGAGTTC
CCCTATTGCGATACCGAGTATGAGATGCACGTGTACTACAACTATACAGCTGAGCACGAGTCGTAAGCGTCAAAATATGCTATCCCTGCCTCTTCTTCCT
AATGTAGCATTTCATCAAGAATAAGCTCGTTAAAATGATTTCTGTCGTCTTATGTCTTTTAAAAAGAAAAAGGCTACATGTAGTTATCCAGCCGACTCAA
AGCAGCTTCCTAACTCCCATGGACGGCTGTGTAATTGTAGTACACAGTGTTCTCGTACTCCGGCGCACAGAACGAGAACTCCTTGTCATCGTTGCTCGGA
GAAAACAAGTTTACACCGTTCGTGTATGTGACGTAGCATCCCAAGATGAGACACACGACGACCACGATAATGGCTGGCACCTTCTCCCACATTGGAATGG
AgctccacttcttcttcagcaggAAAATGATCGGCAAGATAATGGAGTGCAGTGTGATGCACGAAGCCCCAGCAAAGTCGGCCAAGTCCGAGAAGTGGTC
CTTAAAGAGAATCGACGCAATTACAATAATCACGACGATCACGAGCCGAAGAATTACGTACTTGATGGCGTTCGAGCCGCGGTACtcggcagcttcagcg
tcggGATCACCAAGGTGAACATTTTCGCTATCAGCAGCTGAGACGAAGGAACGGCGAGATCGCAAATGCTTTTCCGATCGCTCAGCGGTGTCGTTTGGCG
TAGCTGCGTCAACATAACTCGGTAGGTTGTTCTCAACGTCAGCGGTGAGGACCTTGTGCATGCCCAAGAACAAACGCTCCGAAAGGTAGAAGGCCGGGTT
GAGCAGGATAGAGAAAGCAATTGTGATGTGCACCTGCATGCATAGGTAAGCGAGTACAACAGCCCCCCAATCAGAGGCAAAGCCCAGTGCGCTGAGACCG
GTTTTCGAATCCGGGTAGATTGTCCATAGTAGATTACCCTCAATCTGGCAACCAACGGCCGAGTACGCCGTGGAGGCTAGAACCAGAAAGCAGGACGACG
TGAACAGCATCGTTGCGCCAACCACGCGAGGCATGCGCTTCGGGTCACTGTGCTGACGGTGCAGCGCTGGGATCACGATACCGGCACCATACGCGAGTGC
AAGATTGCCAAAAGCACCAGCCACCTGCTTGAAAGCGAGGTCAGGCTTCGGGATACTTGGGTGGCCACGCATGCCATACATCACAACGGCGACGCCAATG
ACATCAGCAACTAATGTCCCCATGCATCCTGCGAatgcagcgccagctccttcctTAAGTGTGGGCACCAAACACACCGGCAGACACGTGATCGCCATGA
GGATGATCCACACCGTCCCGCTGAAAGCGTCCGGGAAGAGTCCGTCTAGCAGTGTGCCACccagcaccaggaacacgCACGGAACCAGAATGCTGTTCAA
TATCTGAGCGAAGACGCAAAGATAACGGCCGGTCTTGCCCATGACCCACTCACCGAGGTCGCCGTATGTCTTGACGGACGAAGGtgcgagcagcaacaca
cgACACAGAGAGACCGCACCGTAAGCGTTTGCAAAAGCCATGAAGGCCATGGCAAAAATTGCAATCACTGGCCCGGCACGCGAGAAGTTACCGGGCATAC
CGAGCGTGCCAACACCGTACATACAGCAGAAGAGGTTGAATGCCACCTTGACGTCCTCCATCGTGAGAAGAGGATTGCGCGCCATGGTGCCCGATACGTA
ACGAGTTACTTGAGTGCGGGGTAGAAGATTGGAGTCTGAGCT