Description :
From Genome Similarity Track
Location :
Scaffold_394:856- 2375
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_394-abinit-gene-0.37Serine/threonine-protein phosphatase

Sequence
1519 bases(100 bases per row)
ATGTTATACACCACACGTTCCTCACAAGTTAGACAACAGCCGTGTATACAAACAAGCATGAGTGTATACGTACCCGCTCGCGTTCAAAGTTCTCCGCAGT
GGCGTGCTCGTGGTCGCTCAGGCGCTTGAGGATCGTCTCCTCCTGGTTCACGCGGCGCCGGCGCTCCTCCTCAAAGGCGTCCATGAACGTGTGGAGCTTC
TGTGTGAGCTCGTTTGTCTTGTTCTCAATCATGAGCGGGATCTCGACCTTCTCCGTCTCGACGAGGCTCTGCACGCCGCTGATCTCGAGCGCGAGCACGT
CCAGGCGGTCGCTCACTTGTTTGGCGCGGTCGCCCAGCATGGTTTCAAAATTCGCAGTCATCAGCGCGACCTGCTCGTCGCAGTAGTTCTGCAGCGACTT
GTTCATCTCCACTCGCTTCTTGATCTTGGCCTCGAGCTTCTTCTCCAGCCGACTCATCTCCTGCTTCATCTCCGCAAGGCGGAACTCATCGCGCTCCTTG
CGTTGCTGTTGGGAGTCAGCAAGAGGCAATACAACGTCAGTCAAGTGAGGTCAGCAACATACAGCAAGCAATCCACGCAGAGCAGTCAGCGTACACGGGT
GCCGATCCGCATGACATCGTCAAAGGTTGCAAAGTCCGTCATGAGCTTGTCCAGTTTGCTCTTCGTGGCCGTAGCGCTGAGCTGCAGCTCCACCTCGTCG
CCTCCATCACGCTCCCCCTGTTGGTCGTCTGCTGCCGCCAGCACTGTTGTAGTTGGCTCTGTCTGCTGCTGGCTCATCCTTCAGGCTGGTCGCTTGCTCG
CAGTCTCAAATATCAAGTGCCTTTTCAGGAGGATAGCAAGGATACAAGCCTAGAATACTCTATAACTTTATCAGCAGCATTTACACTTGGAGTCGATCAC
GCGCAGGCTGCGCAGGAAGAGCGGGTACGCCACGAACTGCTGCTCCTCCTCGCTCTGCTGCTGCTGCTGCTGGCCCTCGCTACCTTCCTCTGCTATAGCG
TCCGACATTCGCTTACTCTTCTTCGCAGGCGTCCGGTGCGCAAACGCAGCCGCGAGCTGCTCGAGCTCCTCCTGGTCCAGCAGCGAACCGTGCTGCTCGT
TGATCACCTTCATGACCGCGATGAACTTGTCCTTGGCGATAAACCCCATGCGCTTCCCGTCCAGCATGCGAAAGAGAAATTTGAGGTACAGCCGCTGCTC
GTGCAGTGAGTGCTTGACGCTGTCCACCAGAGTCTCGGCCCACGTGTTCCGTCTCGCGATCGCTCCGACGCCACCGCCGATCGGACTGGTCTCTGCGCCA
CTCTCGTCATCCGTGGTTCCATTCGCGGTGCTCTCGATCAGCAACGACAGGTTCGACGTCGACGCGCTCCAGCTCTCGAGACGCAAGCGGCGCTGCAACG
TGCTGTCAGGCGAAAAGACGTCTTCAAAGACGTCCCAGTCCAATCCGCGCTGTTCTTTCTCTCTGCGCATCGTCACACCATAGTAGCTGCGCAGGATCGA
GTCGTAGAGCAGCTTCGCG