Description :
From Genome Similarity Track
Location :
Scaffold_1976:856- 1950
Transcript NameFunction/comments
Phymu_g13796hypothetical protein PHYSODRAFT_341850

Sequence
1094 bases(100 bases per row)
CGAGCGAATCTCGGACATGCGAAGTGGAAAGAGAACCTGATACGGCCGGATCTATCGAGAATTCTTGGTACACTGGGTGGGTTATGAAGAACCGACCTGG
GTCGACGAGGCAGATCTCAACTGTGGAGCAATACTGAGTGCGTTCTTGCGAGATCACGTGAACCGTAACCGATTCGGCGTGATGCAGTCACATGAGGAGG
TGTAGAAAGGGAGATGGCGAGTCGAGGCGGTCGTCTCGCCGTGGTCAACATGGATGATCTGGAGGACGATCCAGATCAGGAGGGGAAGTTTGCATTTTGT
GTGTATGTATATGAAATAAGGAGTGGTCGAAGTTGTTAGATGGTGTTCTCGAGTGGCTAAGTGGTGACAGAGTGAGATCACGGTACGATGGCAATGGAAA
GATAAGAGAGGCATGGATCACGTATGGAACGTTCGAATTAAGAGAAGGGAGCAGTGGAAAGTTAAGTGGGGTCTTGAGACGTGCGATGCCGAGGTGGATC
CATAACTGCCCTCGAGGAGCTGACTCGGAACATCGGATAGCGAACGGAGCTGGGGATCACGGTGCGGCTGGAGGCGCAGGTGGGTTGAACTTGTTTGGAA
GACGTGCGATCCGCATAGAAGGATGATCGGCCGGGTGATCACGGTAGTGGTTCCGCCAGGGGTCCTCCCGGTGACATTCCGCGAGAGCAGTGATCAAGTC
CGTGGGCTCCAGACGATTCAGGTTGGGATCGGCCCGATTCGccgatcgagaagctgatcCGGGGTACCAGTGGACCCGATCTCTCTGGGTGGGCAAATGC
AGGAATATcggatcgagcagaaggTCGATGTCGGCCCACAAATTCCGCATCAACGGGAGGAGagtgaccagcagcagtctccaaCGATGACCGATCCGGA
TTCGACGTTTGCGACGCGCCTTGTGGTACTGCTCGAGGACCGGATTGTTAAAGGTGTTGAGGTCTTGGTAGCGAGGCTTGGGCTGAGCGGAGGGAGTTCT
GCACTTGGTGTGAAGACCGGAGTGAAGACCacttgagctgaagaaggaagattcgaaagtgattgattgaTCGGAGCTTACACTGTCTTATTTA