Description :
From Genome Similarity Track
Location :
Scaffold_44:8558- 9723
Transcript NameFunction/comments
g7520.t1hypothetical protein

Sequence
1165 bases(100 bases per row)
AGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGTCCTTCGTGATCGAGTTGCATCA
GTGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGGAATGGGCGATCTTGGTCGGCTACCGCCAAGATCGGAGCCTCAGTCAAGCCCTGCTT
GACTGCTTCAAAAGACTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTC
ACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGT
CAGGGCGTACGTCGTTCTTCCCCACCAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTCGT
ATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGACCTCCCATTCACAGCCCGGCTGTGAATGAACACATCATCGAAATAGCTCG
GTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTCCCAGAG
CATGTCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCGCTCTCACGCATGATGATCTGATAGAACCCGTCTCTCAGATCAAGAGTACTGAAGATAGTA
CTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCGTCGTTCAGCTTGTAGTAAGCATGAACGATGCGCC
ACCCATCCTGTGGCTTCTTGACACGGAACGTAGGCGCGCTGTGCGGGGACTTTGATTCCCTCATTTGCCCTGCCTTGCGACGACTTTCAAAGAAGTCGTT
GATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGC
GGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAGAAGGG