Description :
From Genome Similarity Track
Location :
contig_46:85551- 89350
Transcript NameFunction/comments
g9580.t1hypothetical protein

Sequence
3799 bases(100 bases per row)
GAGCGTAGTGATATCTGTAAGGAAATGATTCACGTCTTTGATGGAGATCCACGCAAGCACAAAATCCACGAATGTGAGAGCCATAGTCGTGCTGATCGAA
GTAGCATTCTGCATAGAGCTGGCCACGTAGAGCGAGTTGAATACCTCGATGTTAAGAATGATAACCTGCGGCTTTAGGTCATCCTTCGGACCCAAGAAAA
AGCTGATCCAGTTCTTCGTCGCAATCTTAACCACAGGAAGCAGAAGAACGTAAAATGTCTGAGCTGTAGAGCCGACTGAGCGAAAGCCATAGAGATACGC
TGGATAGATGAACGTCAGTACAACCTGGCAGGCGATCACCACGACATAGCTGAACAATTCTTTCCTCAACGCAGCTTCTTGCTTCAACTTTGCTCCGAAG
AAAATCCCAAAGCAAATGACCAGACCAACGAACCACACCGGAATCCCAATCACTAGCGTGAACGGCAGTGGAAACCCGATCAGACTTGTCATTGCTAGCA
TGAACGCCACGGCGCCCGCACTTGGGATGGCGGATATACTGATGGTCCGAATTGTTGTCAAGTCCAGGGATGGCACAGTCAGATGAAGCTGCTGGAGAAC
CGCACGCGTCATGAGCGAAATCGTCAAGTAGTTTCTACCCCAAAACAAGTAGTTTGCTCGAGAGCCGTCCCCAGTTGGGGCTAAAGGGACGCAATCGATC
AGCGTGAGGACGATGAGGCACGGGAATGGCGCCATAACGGCAAACATGCTCGCACGGAACACCGAAGTCGAGCTGGAGTAGTCCTTCAATAACCTCATTC
GGGAAATGGAGTAGCTGCCATGCAGTTCCACTTGAAGGTACATCCAAACGTCAAAGATGCACCGGCATATTCGTCGCAAACCGTGCATTGTGTTACTTGT
GACCAGCCGGTCACGTCTGCAAGTTTTTTCGGGTAGGATTGTTCGAAGTAAAGGTTTCAGGAAAGCTTATCTACATTGGTGATGTTTGAGTCATAAATAC
TGTCACCCTTTTTGAGTTTCAACGCGAGCTTTTCTTCCTCCAGTCTTCCTCTTCGTCATCAAACGAGCCCCACAAGTGTAATGAAAGAAACCCGCATTAT
ATGGCGGCGTATGCGCAAGTTCACGTCGACATTCCAAGCCGAGTTGCGTGGGCACTACTCAATTGAACGAATGCACGATTTGCGCAAATACAGTCACTCA
ACATCATTGCAGCGCGCGATTTGGATCAGTGTGCTGTCGCCATTCCCTTGCCTTATAATTCTGACGCTGATTGATTGTGTCCCGCTGGCCCCACCTGAAG
ACGGTTCCAGCGCAAATTTCCTGTTCTGGGGTCGAGATTTCTTGACGATTGCTCTAATGACGCGTGTTATCTTGGAGCAGTTCCGGATAAGTGTACCGGA
ACTGCATATCAACTCTGTACAGGTTGTTGTAATGCCGATTTTAGCGAGTGGAGGCGCTATAGTATTTATGATCGCCATGTCAAGCATTATCGGATTTCCA
CTCCCGTTCGCACTTGTCGTGGGGATCTCGGTGTGGTTTGCGGTGCTGGTCGTGTGCTTCGCACTGTTCTTCGGTCGAGTCCTGAAGCGAGACCCCGTGC
TGTTCAAAGACTTGCTTAGGTCGATCGTAGTGCTTGTCTGTCAGGTGCTACTGACGTTCGTGTATCCAGCGTATCTCTACGGATTCATAAGCGTTGAACC
TTCAAACCAGAAGTTCTACGTCATGCTGCTTCCCATCATCAAAATTATCGCAAAGAACTGGATCAGCTATTGCCTTGGCAGCAAACACGACCTAACACCA
CAGATCATGATCTTCAATGTCGATGTTTCAACGCGTTGTACGTCGCCAGCTCCATGCAGAAGTCTCAATCGATTACTACGGTGCTGCAAATGGTGGCCCT
TGATGCTCTTCTCGGCTGGGTATCTTTATCCGACATTGCTGATCTTGTGCGAGATGTCCTCAGACTTCGACGTAAGATACCAATGGGACATCCACTGGAA
AAGGCGAGCTTCATCGAAATTGCTCTCCAGATAATCGAAGAAGACCCTGACGTAGCTGAGCGGCTAGCAATGCGTCACTACAGCTCTACAGCTCTAATCG
TCAGGCGCTGACTGGTCCCAGTACGACTTCTGTGGCGCAACCTGAGGTCTTGTCTACCAGTCGGCAAATTCTTCCGGTGGACGAAGCAAATATCTCACTC
CCTACAGCTCCAGACTCAAAACCAGCATCGCTACGACTCGCTCCTGTGCAAAAATCTCTGGGCGATATTTTCTCGGCTAAGGAGCGTCACCGATTTGTGC
AACAAAGCGCACGAGTACTTTTCACGACCGAGTTCGTCATTTTGGTTGAGTACACGGAAGTGGTCGTCCCGTTCATCTACAGTGCGTCTTTGTTGCTTTG
CTCCTCTAAAAGCTACAGACTCACCATGTTTTATTGTCTGACAGGCATGTACACAGCAGGAATGTTTTACCTGCCCAACCGCGACTACTACCCCAACTCC
AGTCGTTTGATCATAGCGGTTGGCAGTAACCTCGGAACCGTGATTGCATTTGGATTTATTGAGTTGATATCTCTCTTGGTGATCGGATTCTTGATCCAAC
GGATGCTTGGAATCTCGACGCTGCAACTTCTTTCATTCGTGCTGGACCGGGGTTGGAGAATGGTGCAGTCAAACTTGTTTCTGTGGATCTGCTACACGAT
TCAGAATTCGTTGGAACACAATGGTGCGTTGGCATTCGTAATTCTCTATACACTGAGTTCCTCTAATTGTGCAATTCTTGTATTAGGTGCCGATTTCAGC
TTTTCCTTCAGTTGGCTCGGCGTATCGGACACGGGGTCTACGTGACTCTTCACTTTTCATCGTTTTGGGGCGGCGGGCAGCATGGCAGCCAGAGGTGCGG
TGACTTCGACCGTGACGCAGCTTACAACTGTTAGCCAAGTTCAAGATGCTGCTAGAGTCTTGATGCAGACTCAAAGCTCCCGGCGGTCGTCCAAAGTCCC
TGCACTACAGGGTCCGAAAAAGATCCTTTTGGTGGAGCAGCAGCTCGATAGCGAGTTTGGCGCCGAGTTGTTCCCTTTGGTAGCGTTTCCAGCGGTGTCA
GCGTCGTTGACGGTGCTCGATCTCTCTTTCAACGAGCTGGATGATCGATTTTGGATGAATTGGACAACGGAGCTGCACGGAGCAGTGTGGCCAGGACTGG
TATCACTGAACCTTGCTAACAATCAGTACGTTGCCACTCAAAACGTTCTCCTTAGCGAATGATATGCCTGTTCACTTATTGATTCCTGTGTGGTAGGTTT
TCAGCTCGTGGGCTCAAAGCAGTCGCGGCTTTCATCGCGCGATGCCCCAGCCTGACACAACTCGACGTGTCACTCAATCTGTTCGGTGAACCGAATTCAT
CGTCCGATTGGATCCAACCACTGATCAGAGCGTTTGATGCCAAGAACCGTGAACCCCTTCAAATTCTGGACATGTCATGCACGGGTGTTACAGACGCGTG
TTTCTCGCAGTTGATGGAAGCAGAATTCTCCAAGTATATTGCCAAGTTATACCTCCGTTCAAATGCACTGACCGACAAAGGAGCAATCACCTTAGGACAC
GCACTGCCACTGATGAAGCTGGAGGTTCTTTCGCTTTCCGGCAACCTGATTGGAGACTGTGGTGCTGCTAGCCTGGCGTTTGTATTGGATCAAGCACCAG
CACTGCAAACCCTCGACCTTGAGCAGAACCAGGTATGAGGTTTTGTCTTTGCGGTCATGCACTGTTGAATAACTCTTGTACCTTGATGACCATGATGCA