Description :
From Genome Similarity Track
Location :
contig_46:85530- 89329
Transcript NameFunction/comments
g10043.t1hypothetical protein

Sequence
3799 bases(100 bases per row)
TTGTAGGGATTTTCTCTAGGAGCGTAGTGATATCTGTAAGGAAATGATTCACGTCTTTGATGGAGATCCACGCAAGCACAAAATCCACGAATGTGAGAGC
CATGGTCGTGCTGATCGAAGTAGCATTCTGCATAGAGCTGGCCACGTAGAGCGAGTTGAATACCTCGATGTTAAGAATGATAACCTGCGGCTTTAGGTCA
TCCTTCGGACCCAAGAAAAAGCTGATCCAGTTCTTCGTCGCAATCTTAACCACAGGAAGCAGAAGAACGTAAAATGTCTGAGCTGTAGAGCCGACTGAGC
GAAAGCCATAGAGATACGCTGGATAGATGAACGTCAGTACAACCTGGCAGGCGATCACCACGACATAGCTGAACAATTCTTTCCTCAACGCAGCTTCTTG
CTTCAACTTTGCTCCGAAGAAAATCCCAAAGCAAATGACCAGACCAACGAACCACACCGGAATCCCAATCACTAGCGTGAACGGCAGTGGAAACCCGATC
AGACTTGTCATTGCTAGCATGAACGCCACGGCGCCCGCACTTGGGATGGCGGATATACTGATGGTCCGAATTGTTGTCAAGTCCAGGGATGGCACAGTCA
GATGAAGCTGCTGGAGAACCGCACGCGTCATGAGCGAGATCGTCAAGTAGTTTCTACCCCAAAACAAGTAGTTTGCTCGAGAGCCGTCCCCAGTTGGGGC
TAAAGGGACGCAATCGATCAGCGTGAGAACGATGAGGCACGGGAATGGCGCCATAACGGCAAACATGCTCGCACGGAACACCGAAGTCGAGCTGGAGTAG
TCCTTCAATAACCTCATTCGGGAAATGGAGTAGCTGCCATGCAGTTCCACTTGAAGGTACATCCAAACGTCAAAGATGCACCGGCATATTCGTCGCAAAC
CGTGCATTGTGTTTCTTGTGACCAGCCGGTCACGTCTGCAAGTTTTTTCGGGTAGGATTGTTCGAAGTAAAGGTTTCAGGAACGCTTATCTACATTGGTG
ATGTTTGAGTCATAAATACTGTCACCCTTTTTGAGTTTCAACGCGAGCTTTTCTTCCTCCAGTCTTCCTCTTCGTCATCAAACGAGCCCCACAAGTGTAA
TGAAAGAAACCCGCATTATATGGCGGCGTATGCGCAAGTTCACGTCGACATTCCAAGCCGAGTTGCGTGGGCACTACTCAACTGAACGAATGCACGATTT
GCGCAAATACAGTCACTCAACATCATTGCAGCGCGCGATTTGGATCAGTGTGCTGTCGCCATTCCCTTGCCTTATAATTCTGACGCTGATTGATTGTGTC
CCGCTGGCCCCACCTGAAGACGGTTCCAGCGCAAATTTCCTGTTCTGGGGTCGAGATTTCTTGACGATTGCTCTAATGACGCGTGTTATCTTGGAGCAGT
TCCGGATAAGTGTACCGGAACTGCATATCAACTCTGTACAGGTTGTTGTAATGCCGATTTTAGCGAGTGGAGGCGCTATAGTATTTATGATCGCCATGTC
AAGCATTATCGGATTTCCACTCCCGTTCGCACTTGTCGTGGGGATCTCGGTGTGGTTTGCGGTGCTGGTCGTGTGCTTCGCACTGTTCTTCGGTCGAGTC
CTGAAGCGAGACCCCGTGCTGTTCAAAGACTTGCTTAGGTCGATCGTAGTGCTTGTCTGTCAGGTGCTACTGACGTTCGTGTATCCAGCGTATCTCTACG
GATTCATAAGCGTTGAACCTTCAAACCAGAAGTTCTACGTCATGCTGCTTCCCATCATCAAAATTATCGCAAAGAACTGGATCAGCTATTGCCTTGGCAG
CAAACACGACCTAACACCACAGATCATGATCTTCAATGTCGACGTTTCAACGCGTTGTACGTCGCCAGCTCCATGCAGAAGTCTCAATCGATTACTACAG
TGCTGCAAATGGTGGCCCTTGATGCTCTTCTCGGCTGGGTATCTTTATCCGACATTGCTGATCTTGTGCGAGATGTCCTCAGACTTCGACGTAAGATACC
AATGGGACATCCACTGGAAAAGGCGAGCTTCATCGAAATTGCTCTCCAGATAATCGAAGAAGACCCTGACGTAGCTGAGCGGCTAGCAATGCGTCACTAC
AGCTCTACAGCTCTAATCGTCAGGCGCTGACTGGTCCCAGTACGACTTCTGTGGCGCAACCTGAGGTCTTGTCTACCAGTCGGCAAATTCTTCCGGTGGA
CGAAGCAAATATCTCACTCCCTACAGCTCCAGACTCAAAACCAGCATCGCTACGACTCGCTCCTGTGCAAAAATCTCTGGGCGATATTTTCTCGGCTAAG
GAGCGTCACCGATTTGTGCAACAAAGCGCACGAGTACTTTTCACGACCGAGTTCGTCATTTTGGTTGAGTACACGGAAGTGGTCGTCCCGTTCATCTACA
GTGCGTCTTTGTTGTTTTGCTCCTCTAAAAGCTACAGACTCACCATGTTTTATTATCTGACAGGCATGTACACAGCAGGAATGTTTTACCTGCCCAACCG
CGACTACTACCCCAACTCCAGTCGTTTGATCATAGCGGTTGGCAGTAACCTCGGAACCGTGATTGCATTTGGATTTATTGAGTTGATCTCTCTCTTGGTG
ATCGGATTCTTGATCCAACGGATGCTTGGAATCTCGACGCTGCAACTTCTTTCATTCGTGCTGGACCGGGGTTGGAGAATGGTGCAGTCAAACTTGTTTC
TGTGGATCTGCTACACGATTCAGAATTCGTTGGAACACAATGGTGCGTTGGCATTCGTAATTCTCTATACACTGAGTTCCTCTAATTGTGCGATTCTTGT
ATTAGGTGCCGATTTCAGCTTTTCCTTCGGTTGGCTCGGCGTATCGGACACGGGGTCTACGTGACTCTTCACTTTTCATCGTTTTGGGGCGGCGGGCAGC
ATGGCAGCCAGAGGTGCGGTGACTTCGACCGTGACGCAGCTTACAACTGTTAGCCAAGTTCAAGATGCTGCTAGAGTCTTGATGCAGACTCAAAGCTCCC
GGCGGTCGTCCAAAGTCCCTGCACTACAGGGTCCGAAAAAGATCCTTTTGGTGGAGCAGCAGCTCGATAGCGAGTTTGGCGCCGAGTTGTTCCCTTTGGT
AGCGTTTCCAGCGGTGTCAGCGTCGTTGACGGTGCTCGATCTCTCTTTCAACGAGCTGGATGATCGATTTTGGATGAATTGGACAACGGAGCTGCACGGA
GCAGTGTGGCCAGGACTGGTATCACTGAACCTTGCTAACAATCAGTACGTTGCCACTCAAAACGTTCTCCTTAGCGAATGATATGCCTGTTCACTTATTG
ATTCCTGTGTGGTAGGTTTTCAGCTCGTGGGCTCAAAGCAGTCGCGGCTTTCATCGCGCGATGCCCCAGCCTGACACAACTCGACGTGTCACTCAATCTG
TTCGGTGAACCGAATTCATCGTCCGATTGGATCCAACCACTGATCAGAGCGTTTGATGCCAAGAACCGTGAACCCCTTCAAATTCTGGACATGTCATGCA
CGGGTGTTACAGACGCGTGTTTCTCGCAGTTGATGGAAGCAGAATTCTCCAAGTATATTGCCAAGTTATACCTCCGTTCAAATGCACTGACCGACAAAGG
AGCAATCACCTTAGGACACGCACTGCCACTGATGAAGCTGGAGGTTCTTTCGCTTTCCGGCAACCTGATTGGAGACTGTGGTGCTGCTAGCCTGGCGTTT
GTATTGGATCAAGCACCAGCACTGCAAACCCTCGACCTTGAGCAGAACCAGGTATGAGGTTTTGTCTTTGCGGTCATGCACTGTTGAATAACTCTTGTA