Description :
From Genome Similarity Track
Location :
scaffold_191:8553- 11836
Transcript NameFunction/comments
Pl_107971conserved hypothetical protein
Pl_107972conserved hypothetical protein

Sequence
3283 bases(100 bases per row)
CCCCGAGCAGTTGTTTCTATCACGAGACTGACGAAACCAGTGTGGAAGGCGACGAACTCGTCCAATGTACCATCACATTCATCTTGAAACCCGTCCAGAG
CGCTCGTTAACGTGTACTCTTCCGCCTTGAGCTTGGCGTGCTCGACACTTTCCGCTGCTAGACGATCGATATCACCTCGGAAGCACCGCACAAATTCCTG
CAGGATGATCAGACTCTTTAGTCGCCCCAGTTGCAATGACACTTCTTCAGCGGAGAAGTCACGACCCTGGATAGCTGCTGGTGTTGCACAAATGACGGCA
ACTGAGACTTGTGCTTCTACGTCCGAGGATATCAACACCGTGAATCCGTTTTGTAGCTCGAGGTGGCCAAAGGGCTGTGCTTGAGCGAAGTGGAAGAGGC
TGGCAAGGAGCATGGCTAGCTGTGGATACCGGAATGGCAATGTGTCATCCTGATCCCATAAAAGCAGAATGCGCCCCGACGTCGTCACGATCAAGCATGC
AACAGCAGAACTACCCTCAGACATTGCAAATGCGTACTGTCGGCAGCTCCTCCTCTCGATCAAGGCTGGTAGGAGCACATTCGTTGCGAGACAAGCACTG
CTGATCAAGAAACTGCGGTGATCTGCTATTTCTGTGAACGTAAAACGTATTGACAGGATTCATTTGTGCTATGGACAACGATACTTAAGCCAGTAGTGCT
TCCCATGGTTCCTCAGGATTGCCTGCACATATCATTGCTCTGGGGGACTTCAGTACGAGAGGTTGGACTCCCTGAGCTCATAGAAGTGTCATCTAATGAG
CCGAATCGGACTGGAACTGCAGTGTCCTTCGGCTTTGAGGTTTTCACTGAACGTCTTGCAGGTTGATACTCACCCGCGGCAGGAGCAGGAGCTTGCATCA
ACGGAAGCGGCATCATAGGCATCGACTTAAAAAAATCGCGCTTAGCAGCAGCGGAAGCTCTCGCTACCTCCTCCTCAGTCTCAAATATGGCCAACTTTTC
CTGAATGTCAGCGATCTCTCTGTCCAAAGCTGTGCTCTCTGTAAGTATAGCCTTCTTCTCCTTTTCATGAGTAAGTCTGAGCGAGATCAGGTCCTTCTTT
GCCTGAGACTTCAGTTGGCGCTCGAACTTGGCCTGCTCGATTCGCATGCTGTCCATCTTCTTGGCATGCTCATTCTTCATCGCAAACACCTTCTGCATAT
GCTTTGTTTTCTTGTGCACCAACTCGCGCTCCAATTGAACAATCTGAGCCATCAATTCCTTCTGCTGAACAAGCAACGATCGCTCTTCTTTGTGAAAACT
GCGCTGCTTTTCTAGAACCTGCTTAGTGGCAGCAGCAACCTCTTCCTTACGCCGACGATCTGCTGCGATGGATTTTTCCAGCTCCTCTGTTCGACTACGA
GCCCAAGCAAGGTCACTCTCTGCGTTCTTCACACGTACTTCGTGCTTTAAAGTCATGGTCGTGATCTCTGTAGTTAGGTGTTCCAGCTCACCCTTTTTGC
TGCTAAGTTCACTTTGGAGGGTACGACGTAGTTCGGAGAGCTGCTCCGTAGCATGCGCCAATTGCTTCTCGTATGAGCCCTTCTGGTCGTTTGTAGATGC
GGTTGTTTCTGCGTCTTGCACCTTTGCCAACTCGAACGCGCTATCAAGCTGTTTTTTCTCCTCCTGCCAGCTCTGCATATGCGTTTTATATTGCTGAAGA
ACCATTGTGCTCCACTTCTGAATGGATCCGCGTACAGTCCGCAGGAGAGCCTTCTCAAGATAAGGGTCCACGGCTGGTCCGCTGCTTTGCTGTGCATACT
CGTCGAGTGCGCTTCGCAAATCTGACTTATACTGAGTTAACAGCTGGACCAAACCATCGGAAAAGTCTTCACGGGAGTTTTCAGCGAGCTGTTTGCACAT
GGCCTCAAGGTTCCGTGGGAGAACACGCTCCAGGATCTTGGTGCAGATTTCTGTCGATAGTGTGGTATTACGCTCTAGAGTTACTTGAAAGTTGAGCTTC
ACCTGAGCCTGCCACTCAATCACCATGTCCTTGAAAAAACTCTTCTGCAGTTTCTCCGGAAGACTTGAGCGCACCGCACGAATATGCGCCATGGCCGCCT
GAGCACCACGGAAATGAGCAAGATATATACCTCGCTCACTGATGGCTTTGTCATCGTTGCCCTCCTCTTCAAAATTTGTCGCCGCTTGCATCTCTTTAGT
GTAAGTCAGTTTTGCTACTTCAAATGTTTCAGTGACTTCTTGCTCCAGCAGTGCATTCGACGCTTTCTGCATCGAGGGAAGCTGTCCAGTGTTCATTGCA
TCCACATACGCATCAAGCACACCGACAAATTGCTCCGAGCGCAACTCGTGGCCCATTAACTTCTTCGAAGGCAACTGATGGCTCTTGTTTGACAAGTAGT
TCGCATACAGTTCGTCAACTGCCTCGACAAACTGCGTGCGCAGCTCACTACGAGGCGTTTCAGGCGGGACAACTTCCGTTCCATTGCCCTCCACTGCACG
ACTCAGTGCCACACAATCTCTAACAGGGAAGTACGACTCCATGTACATGCGCAGCATGTTCCTCTTGGTAGCAGCTTCTCCGTATCCTCCCTCCGGAGTC
AAACACTGCTCGAAATACTGTGTTGATGTCAGCTTCTGTCCCCCCACATCTTTAAGCCACTTGATCTTGAAGTTCCTGGCCAACCAGATGAACTTGGGTG
CATGCTCGTGAAACTCACTTGCTGCACGCACACGAACGCCAATAGAATCAGCTGTTAGCATCTGGAGAATTCTAAAACCAACACTAGATCTCACCGACAG
CTTCTTCGTCCTGCATAGACTTGATTCTCAGCACTTGAGCCACCTTCTCCAGCCACTGCAGCTTCTCTATAGCCTCAGCATTAACCTCTCCGTCTGCGTT
GTACAGCAGAGCAGATGAGAGCAGCAATAACAGCGCTAGCTTCTGGTCTTCTGTATGGTGCGTGTTGTCAGCCGCTAGAGCAGCTCCAGCGGTCAGAATG
ACGCAATTCTTGTCTTCAGTCTTCCTACCTTCGTCTCCAGACAGCCAGAGCCACAAAAGTACGTCGTTTTCTCCCTCATAATCCGCAGAAAAGTCCACGT
TCTGGGACTGCAGCATAGTTTTGAGCAGCAGGTGTTTGCCACTCGCTGGAGGACCAAATACGCCCATAACACCAATATTCTGGGCATGCATCGAAAGCAG
AGCGTCTCGCGCATCGGATGAGACCTGTAGTGTCGCTCTATCACCACTAGAAGTCGAGAAAATGAGTGGCAACACGCGCCATT