Description :
From Genome Similarity Track
Location :
contig_166:8553- 9702
Transcript NameFunction/comments
g13995.t1hypothetical protein

Sequence
1149 bases(100 bases per row)
CCGACGCTGACTGAGTACATGACTGTGTTCAAGAGGAATATCCCTGCTCCATCTCAGATGGGTCCCGTCTTGGGACGCAGTTCCTATATCGACGACATTG
CACATGGAGCTGAAACCTGGGACCAACTTTGTGATGATCTGAACGCACTCCTTTTCAGGCTGAGGTACTGGAATATTTCCGTGAGCCTCCCTAAAAGCGA
GTTCGGAAAGAAGTTGGTCCCGTATCTGTCGCATGAGATCAGTGCTGAAGGCATCCGGGTGAAAGGTGTTCAGGACTTGCCGTTCCCAAGCACACTGGAA
GGGGTACAATCGTTCCTCGGAAGTCTCAATTACTATCACAAGTTTATTGAGGACTTTCCAGTGGTAGCTGCGGTTCTGTATGAACTCTCGGATGACCAAG
TGCGTTCAGGACGTAATCTATCAAGAGTAAGGAGGCCTTTGGAATCCTGAAGCGGAAGATTGTCTCGACTCCGTTGCTACGCCATCCAGATCGCTCCCGA
CCGTTTGTCATCATCCCGCATGCCAATCCGTGGGCTGCATGCGCAGTCCTCGGGCAAGAATATGATGGGAGGATACATCCAGTCAGGTATACCGGTCGCG
TCCTCAACGATTCCGAGGTGAGGTATCATGTCGCCGAGAAGGAGGTGATCGCTATCATGAGGGTGCTTCAGGTGTTCCGGACGATCGTTGAACATTGTCC
ACTGATCATCTACACAAGGTACTCCGTTCTGAAGTGGGTCATCACTTCCAAATCTGCCGACGGAAGATGCGTCCCATGGGGACTTGCGTTATCCGGGCGG
AACATGGAAATCCGGAAGTTTCAACGGGACGAGGACGGTCTGGCTGCTATCATGGGCGCTGGGATCACTCCGCGTGAACATTTAGACAAAGATGCTGAAT
CACTGATTCCAGCGAAAGGGGAGATCCGGCAACCGCCTGTGGTGAGTGTTGATATGTTGGATACAGATTACGATGGAATCGTCCTTAGTTTCGATGGAGC
TGCCAAGACGTCGACTCGTCAAGGAAGCTGCGGGTGCATTGCCCGGTTGGACCGTTCTAGAAGCACACGGTTATATTCTGAAAGATGTTACTGTGAATGA
CGCTGAGTACTATGGACTATTGAAAGGTATGGCGATGGCTTCCGAACGT