Description :
From Genome Similarity Track
Location :
Scaffold_74:85523- 88062
Sequence
2539 bases(100 bases per row)
TAAGTCTGATAACGACAATGTGCTGAATACCAAGCCCGCTCCAAGACCAAATCTGGACACCAAGCTGGCACCAGAACCCGCCCTGATGACCAATATATCC
ACGCGTGTGCGCTACTTTGATGACAGTGATGGTAGTAACAGTGGAGATGATCGTGAGAGTGAAAAGAGCGGTGATAGTGCGTTGAGTGGCGGTAGTGGAG
AAAGCAGTGACGGTGAAGAAAGCATTGGTGATGGAGCGAATGGTGTCAGTAAGAGTGAGCGTGATAAAACTAAGGGAAGCAGCAGTGACAGTGACGTGGA
AATGGTGGACGTTGTCGAAGTCAGGGGTCAGAGTATATTCAAGGGTGGAGTCGCAGCAGCCATTGCTGCAAAACCTGTGCACAGAGAGAAAACGCGACGC
TTTTTCAGGGCAGCTACGTCCCTCTGGTTGTGTATACTGACCCACAGACAAGCTACACTCTGCATGTTTTCACGGACGATTCAGACAGCCTTCTGAACAA
CGCAGAAGAAGACGGATAAGCGAGGAGAAGACACTGTACATATGTACGTGAACGGGGTGATGAAGTGTGTTGCCGAGCCGGCTGGATCAGCCGCCGATTT
GACCTCGTACTCATTCCGACGCGGTGGAGCCCAGCACGCGAACGGAGAGGAACGCCAAGCTGCTCAGTGGATCTTTGACCGCAGCGTGTGGGATATTACG
AAGACCAACAAAGCTTCGCCTACATCGTGAACACAGCGCGTGAAGACAGGATGGTGGCTCGCGTTGTGAGCGGCTGGAGCGCTGACAACAAGCCAGCAAT
CCTCGGCACCGTGAAACTAGACCACACGACTCAAGAACGGCTTGGGCGTTCCCAGCCGCGCCTCTTCGGTTCCTGCTCGGGTCTGGAGGATCAATGGCTC
ACAAGGTTATCAGAGTTCTCACTGCGTATTTCATCCGGTACTACCGAGGTTGAAGAAACATTCGCCAACTGCCCCCATTGCCATACGCATGGAGGAATTC
ACGATGGCGGCTGCTGGCATCCTGACCGCTGACGGTGTGTCGTCCTGAATAAGGATGCCTCTCCACCTGTCCAAGAACCAGAGCAAGATACAAACCAACA
TTCAAGCCCAAGAACCGATCACCTTTTATATGTAATAGACGAGCCCGAACAAGGCCATGGCTCGTGCATGACAATTGTTTAGGCTGCCCTGCTGAAGTCT
AAGGAGCTACCAGAAACAACTGAAGAAAAGCAAGCACATGCGCCATCAGATCAAGAACCCAAGCCAAAACGCAGAAGAAACAAGCTACGAACCTGTCGAC
AGTGGTACACGCGCATGCCGTGCGTCTGAGATTCCACCGACCGCCAGAAAAAATGGACCCCCGCTACGTTTATCGTTTTTTATGACGTTCTCCCTCGATG
ATGGCTCTATCCTTGACACCAAGGCGGATGGATTGAAGAGTCACGTGGTAGAAATTTGTCGTCTCGAAAAGCGCAACATGCTCGTGTACTTTCCGGGTAG
TGGAACCAACGCCAAGGGAGCCGGTTCGTGAGATGCGTGAGCTGCTTCGATCTAGTAGCGAATCGTCGCTTACAGACACATAAAAATACTCTTATGGACA
GGACACGTGTAATAAGCGTGTGAAGAACTTTCCGAGGATACCAGAAAACAGAAATGCGGACTTACTCTACCTTCGGCTGTCGTATAACCCGTACACGTGT
CGAGTAACCCGTATATGTGGTGATATAGGTGGTTGTCGAGTAACGTGTATAGCGAAAACAATCTCGTTTTGCAAAGAGAGGAGCAGTGGACAAGGCCACC
GCAGTCACTGGCCAACAGAAGTTGGAGACTCTTTCACTATGGAAGCTGGAGAGGCGGGCTACCACTGAGGCGTCCAAACACCTGCGGTTTTGTCGACTAA
CGCTGATTGGATGGCGTGCTGCTGAAAGGAAACTCCAAGCAGGAGTCAACAATGCCATCAAGGCTCGACCCCGTCCCGCATCATCTACACACGGCTGCGG
AGAGGGTATCTTGAATACGGTCAAGCTCTCTAGCGATATCGACTCCCGAAAAACGCGAACTGCTATCGTCGGCGACTGTGCAGTTAAAACACCTAGGTTC
GTTACCCGTACAAGAGGAGAACAACTCTCGTGGTTAAATAGATTTATAAGCGCCACAAGCTTAGTGAATTTATCGCCATCTATGATTTCCACATGCAGCC
CAGCAAGAAGAATAAGTCCAAGGCCTCGCTTCCTGATGTATTGGATTCGCCCGCTGAAGTCCCTGCGGCGCCGCTGAAAGTGTGTCCAGAAAGCTGTGAG
ACAATTCCAGGTTCTCAATTGGATGTACATTTCTTGCCATGGAAACGCCCCATTCTCCGTTGGAAATGCCATCCGTGATCGATGAATCGGTAGAACCGCC
CAAGAACAAATCACTGGTCGACAGCACTGAAGAAACGATGGGATATGATTCTGGCGGAGAATAATTTAACACGTACGTAGATCCATCCAATGTTGTCTGC
GAGACTCAAACTTTCAGCTTTGCTCCTGGAAAAAACAAC