Description :
From Genome Similarity Track
Location :
Scaffold_255:8551- 12496
Sequence
3945 bases(100 bases per row)
TTGTATTGCTTGGAACCGTGCTTTCGCCTTGGCGCTCTTGTTGAACTCGTACAGCAAAGCTCCACAACTTAGCTGAGACATGGGAAGCCACTCAGTGTCA
GGGTACCCCTTCCACTTGACCAAGTACTCCCGGACTCTCCGTGAAGGCCGGGTCCGCTTAACCCAGCGCACATCCTGGATGGCCTCCACTTCATACACAT
TCTGAGCTTCATCGGGTTCTTCAGCATCTTCGGGCAACAGAGCTGCGTCCAGATCATCATCCTCAGCGACTTCAACCTCAACTGTAGGTCGTTCAGGGAA
CAGGCACGCGGCTTGAGTCGACTTATGTGGACCCAAGGATACAACTTGTACCCAGTCCCTTCGATCTTCAGCTTGCATCGGAAGTCATCTGAGGTCTCCA
GAATCCGGAACGGACCGTGCCAGAGGTGAGCGAATTTCTTCGTGAGCCCAGGTTGCACTCGAGCTAGGTACAGCCACACAGCATCACCAACTTCGAAACC
CTTCTTGAGTCTCTCAGACAGCTCAGCCCAGATTTTTGTCTGAGCAGCCGAGCGTTTGACCTTGGCCTCAGCTTGTAAATCCTTAGCCCAGGCCTGAGCG
TACTCGTACTCGCGCTGAGTCTTGCGATGTCACTCATAGGCAGTCCTCTGATCCAAGCCCGTCGGAGATGGTCCCATCATGGCCGAAACAGTGCTGTGAG
GGCCCCAGCCGTGAACCAGGTAGAACGGCGTGTCGGGCCGGGTGGCGTCGAAGGACGTGTTCAGAGCCCACATCAACTTCTCCACCTGGTCGTCCCAGTC
GCTCTAATCTGGCTCAGCGACGTACGCTCGGATGGCTCGAACCACTGTTGCACTGAGCGCTCTTGCTTGCCATTTGCCTGAGGTCTGTACGCCAGAGTCA
CACGCTGCCGACTTCCAGCATCTCGCGGAACCTGGCGAACACTCACTCATGAAGCGTGGATCACGGTCATGGCGGAGCAGAGAGCTCGCACCAAACCTCT
GGAACACACACTCCATGTAGGCCTCGGCGACATCTTGAGCTGTGGTCAGACTCATCGGCTTGCACATGATGAAGCCTGAGAATGCACACTGGAACAGGAG
CAGGAACACGTTTCCACGGTCGGACTTGGGTAGATGCGTAACGAAATCCATAGAGATCACCTCAAAGGGCTTAGTCGCCAAAATGTTTCCCGGCGACGGC
CCAGGGTTGGGCGGAGCTCCCTTGGTAGTGACACAATCCACACATTCCTTCACATAGCGTTCCACATCCGCGTACATCCTCGGCCAGTAGTACTCTCTGC
GCAGTTGTTCGAAAGTCCTAGTGATCCCTTGATGACCACCTTCGAACTCCTCATGACTGAGCTGAAGCAAGTCATCCCTCAGCGCCGTTGAAACAACCAA
TCTCAGATTCCTTGCTGCGTCCCTGGGCCTTCCCGGAGTAGCTCGACTCAGATAGTACAGGACTCCTCTCGAATCAAGCGTGAACTGGTCCACCACCTTG
GCCACATCTTCAGCTTCAGTAGCAGAGAGATTCCCCAAGTCTCCGTTCAGGTAATCCTTGAGCTTCTTCGTCCAGGGCTCAGCCTCCTGCAGAACTAGGA
TGCGTCGCCATCGTTCAGCGATAGGAGTTGCTTCTTCAGGTGAGTACACTAGAGCTTGCTCAGCGGGGGCCTCAGCATTCTGGTCGGGGCTCCGACACCT
TGATCGGAGTCTTCCCTGGCTGCTGTGGTTTCAGCGTCCCTGACCCGAGCTTGGTTCCTAGTCACCACGAAGATCTTAGCGCTGGGCAACAGGGGCTTGG
CAGCATACTCCAGCGGAGTTGGCTCAGCCACTACTTCCACATCAGCTTGAGTGTCAGGCTGCTCTGTCTCAGGTTCAGCAGGCTCAGGTTCATTCACCTT
GATCAGCTTCTCCGGGATCCGATTCAGTTGTTTGAGCTGAACCAGCTCAACCGGATCCTCAATGGCGACAGGACCTTGAATCACCAGAGTCTTCGACGTG
AGGTAGTCCGCAGCTGCGTTATATTCTCGCTTCACATGTACCAAGCGCAATCGTTGGAACTCTGGTCGAAGCGTCTCAAACTCAGCTAGCAGCACTTGCA
GCCCTGGGCTCAGACACTGGATCAAGCCCTGAGCTTGCTGAATGACAATCCGAGAGTCACCGACCACCACAAGGTCTGACATGCCACGAGCCTTCGCCAT
GCGAACTCCCTCGAGCAGTCCATGGTACTCGGCTTCGTTCACCGTAATGCCTTCAAAGTGGAATCCTCGAGCTTCGACCGGGAGCTTCCACAGAATGCAG
CCAGAAGCACCAGAGCGATCCGAAAGTTTGGCAGCTCCATCAAAGCTGAGCAGCCATCCCTCGTAGTCCGCTTCCAGCACCTCCAAGCTGATCGGTGGGG
CTCGGACAACTCGTCCCTTGTCCGGGATGAGGTTCTCTGCGATCTTGTCCAACTGGTCACGGGGGTGATCCCAGCTCCCATGATCGCGGCCAAACCATCT
TCATCGCGCTCGACCCTATGAACCTCCAAGGGCCAGAGCGACAGACGTGCAGCCCACTGCTCACAGCGTCCCTCTAGCGATCGAGACCTGAACAACCACT
TCAGAACAGAATACCGGGTGTAGACCTTCAGCAGCTTGCAACCGCTCAGCATCGAGTAGAAAACTCTCAGAACCCGGAGCAACGCAACGACCTCCTTCTC
AGCCGGGTGGTATCTGAGCTCCTGATCATGCTGTGACCTCCCAGTGTATCGCACCGGGAAAATGACTCCATCATACTCTTGGCCCAGCACTGCACAGACC
GCCCAGGGGTTAGCGTGTAGAATAATCACGAACGGCTTCTCCCTGTCCGGGTGTCTGAGCAGTGGGGTAGAGACAATCTTTTGCTTCAGGATTTCAAACG
CCTCCTTAGCTCGGCCGAGATCACGTCCAGCTTGGATCTGCTCATCCGCCAACTCGTAGAGCACAGACGCTACAACCGGGAGGTCTTCAATAAACTTGTA
GTAGTAGTTGAGACTTCCCAGGAATTTTCAGCGTCGTCGGGAATGGCAGGTCCTTGACTCCCTTGGCGATCTTCGGCTTAGCTCGGATTCCCTCAGCTCC
AATCTCATGCGAGAGGTAGGAGATAGACTTCTTGCCAAACTCACTCTTGGGCAAGCTTACTGAAATTCCCCAGTACCTCAGTCGATAAAGCAACCGATCC
AAGACTTCGCACATCTGGTCCCAGGTCTCGGCTCCATACGCGATGTCGTCGATGTAAGAGCTTCGTCCCAGAACAGGACTCAGCTGAGGCGGGGCCGGAA
TGTTTCGCCGGAACACGGTAGTCTCCTCAGACAGAGGCGGGATTTCTTCCTCCTTAGCGGAGTCGTCCACCTCGATTCCTAGGAACTCCAGCACATCCGG
ATCAACTCGGGCCTCCTCGCAGGGCGGAAGTCGCACGAAACCCCACAGACAATTATCGAGCATCTGCTGGTAGATCAGCGGGGCGTTCTTGAGACCAAAC
GGCATGCGCTTCCACTGGAAGTGTCCCAGCGGACAGATGAAGGCTGAGATCAGCTTGGCCCGGAGTGTCATCGGCACTGCCCAGAATCCGCTGGCCATGT
CCAAGCTCAGGGACCACATCGCTTCCTCAAACCCGATCAACAGATCGTCAATCAAGGGCATAGGGTAGTGTGAGAGCTTGATCAGTTGGTTGACCAGTCG
ATAGTCGATGCACAGCCTGATATCCACACCGTTCTTCTTCATCACAATCACAATTGGCGAAGCCCAGTCTGAGTGCGAATACTCGATGAGCCCAGTCTCC
AGCGACTTCTTGATCAGAGCAAACACCTTGTCGAGCAAGTGCGTCGGAACCTGCTGAGACCTCTGAGCGATGGGCTTCGCATCCCCTGCATCCAGATCAC
AGACAACTCCATGGGCGGGGGCCGGTACCGCATTCCCGTCCCCGA