Description :
From Genome Similarity Track
Location :
contig_166:8550- 9699
Transcript NameFunction/comments
g14520.t1hypothetical protein

Sequence
1149 bases(100 bases per row)
GAAGTCCCGACGCTGACTGAGTACATAACTGTGTTCAAGAGGAATATCCCTGCTCCATCTCAGATGGGTCCCGTCTTGGGACGCAGTTCCTATATCGACG
ACATTGCACATGGAGCTGAAACCTGGGACCAACTTTGTGATGATCTGAACGCACTCCTTTTCAGGTTGAGGTACTGGAATATTTCCGTGAGCCTCCCTAA
AAGCGAGTTCGGAAAGAAGTTGGTCCCGTATCTGTCGCATGAGATCAGTGCTGAAGGCATCCGGGTGAAAGGTGTTCAGGACTTGCCGTTCCCAAGCACA
CTGAAAGGGGTACAATCGTTCCTCGGAAGTCTCAATTACTATCACAAGTTTATTGAGGACTTTCCAGTGGTAGCTGCGGTTCTGTATGAACTCTCGGATG
ACCAAGTGCGCTCAGGACGTAATCTATCAAGAGTAAGGAGGCCTTTGGAATCCTGAAGCAGAAGATTGTCTCGACTCCGTTGCTACGCCATCCAGATCGC
TCCCGACCGTTTGTCATCATCCCGCATGCCAATCCGTGGGCTGCATGCGCAGTCCTCGGGCAAGAATATGATGGGAGGATACATCCAGTCAGGTATACCG
GTCGCGTCCTCAACGATTCCGAGGTGAGGTATCATGTCGCCGAGAAGAAGTGATCGCTATCATGAGGGTACTTCAGGTGTTCCGGACGATCATTGAACAT
TGTCCACTGATCATCTACACAAGGTACTCCGTTCTGAAGTGGGTCATCACTTCCAAATCCGACGGAAGATGCGTTCCATGGGGACTTGCGTTATCCGGGC
GGAACATGGAAATCCGGAAGTTTCAACGGGACGAGGACGGTCTGGCTGCTATCATGGGCGCTGGGATCACTCCGCGTGAACATTTAGACAAAGATGCTGA
ATCACTGATTCCAGCGAAAGGGGAGATCCGGCAACCGCCTGTGGTGAGTGTTGATATGTTGGATACAGATTACGATGGAATCGTCCTTAGTTTCGATGGA
GCTGCCAAGACGTCGACTCGTCAAGGAAGCTGCGGGTGCATTGCCCGGTTGGACCGTTCTAGAAGCACACGGTTATATTCTGAAAGATGTTACTGTGAAT
GACGCTGAGTACTATGGACTATTGAAAGGTATGGCGATGGCTTCCGAAC