Description :
From Genome Similarity Track
Location :
Scaffold_1479:855- 2091
Transcript NameFunction/comments
Phyta_totarag13085helitron helicase-like protein

Sequence
1236 bases(100 bases per row)
ATCCTTCCTTGCTGCAATAGGTAGCTCCATACTAGTAGCAGAGAGCATCAAGCATTAGAACGGGAGCAACAGgctcaagctcgtcgtcgcttgaAGCTTT
GCGCTCGTCCATCTGTGGCGTCAAAACACACAAGAAGGAGTTGCACTTCATGTTATCTAGaatatgttttttttttaattttaatTTTTTCCTGTCAAGC
GCTCGGAGAAGAGCACTAGATAGTATTGCGGCGTGTTTGGATCCCAAAAATACGATAATCGAATATATCAAGCTCACCCGACGATCGAGATTGCTGAATC
GAGGTTCCAAACGCGCCAAAACGAGATCTACGATTTGCAATCTAAAAATAGCATTTTGGGTGAAATCATGAGCAACTGTGGAGGTGGATCCAAACAGGCC
CTAAGTGAGACTGGTGTTAAGACCCACTGGTCAAGGGTCTAAAAGAATAAGTAGCGGCTGTGTGTATTGTATAACTCTATATTTGTTAGGTTATCTGAGG
NAGCCCGGTCCGCCGAAGGTAAACGACGCCCAAAGGGATTCCACAAGGCCACACACCAACTCCGTTAGGAGActtcgttccaaacgagGTTTCCCGTTTG
GAGTCTTACCACGCGACTTTCCTGAAAGTAAAAGGGAAGCGTTATCTGGGGGAAAGCGCTATACGCCACCTGGACGGCAAAGGGTGTTCACCCCGCCTCG
TCTCACAATTACAATTGCTGCCACTTCGGACGCGATGGGTATGTTGTGGGTTCTTGGGCTTGCGTTCCGATCCTCATGTAAGCGGAGCCTGAAATCATCG
CCAGGAGGGATATAGTCCTTCAAGCGCAAGACTGGGTCGTCGTATGGTatgtcttcagctgctgctcgacggcGTTCGTGCTCAGCGAGGGCAGCCTCAT
ATTCAGGCCCAGCGCGGCGAACCAAAAGACTATGTGCATTGAGAAAGTGTTGAGTGTATCCGTTGTGCTCTGCCAGTACCTGGTCAATCTTTCTAAGAAC
CGCCGGATCAAGTCCACCCGTCATTCGCATCCGGTTTGCCACGCGAGCTACCGTCTCCGGATCGTTAATGTATAGTTCGGCAAACATGACACGTCCGTAT
CGAGGAGGTAGTAACGATCTCAGGCGGTGGCACACCGATCCTTGCACACGGAAGTTGTACACGCCATCACCTCTCGTCACACTTTCGTCCACCACAAGAG
AGAGAGATCGCGAAGCACCCAATGAAGCGAACACGA