Description :
From Genome Similarity Track
Location :
contig_46:85486- 89265
Transcript NameFunction/comments
g8176.t1hypothetical protein

Sequence
3779 bases(100 bases per row)
AGCACAAAATCCACGAATGTGAGAGCCATGGTCGTGCTGATCGAAGTAGCATTCTGCATAGAGCTGGCCACGTAGAGCGAGTTGAATACCTCGATGTTAA
GAATGATAACCTGCGGCTTTAGGTCATCCTTCGGACCCAAGAAAAAGCTGATCCAGTTCTTCGTCGCAATCTTAACCACAGGAAGCAGAAGAACGTAAAA
TGTCTGAGCTGTAGAGCCGACTGAGCGAAAGCCATAGAGATACGCTGGATAGATGAACGTCAGTACAACCTGGCAGGCGATCACCACGACATAGCTGAAC
AATTCTTTCCTCAACGCAGCTTCTTGCTTCAACTTTGCTCCGAAGAAAATCCCAAAGCAAATGACCAGACCAACGAACCACACCGGAATCCCAATCACTA
GCGTGAACGGCAGTGGAAACCCGATCAGACTTGTCATTGCTAGCATGAACGCCACGGCGCCCGCACTTGGGATGGCGGATATACTGATGGTCCGAATTGT
TGTCAAGTCCAGGGATGGCACAGTCAGATGAAGCTGCTGGAGAACCGCACGCGTCATGAGCGAGATCGTCAAGTAGTTTCTACCCCAAAACAAGTAGTTT
GCTCGAGAGCCGTCCCCAGTTGGGGCTAAAGGGACGCAATCGATCAGCGTGAGAACGATGAGGCACGGGAATGGCGCCATAACGGCAAACATGCTCGCAC
GGAACACCGAAGTCGAGCTGGAGTAGTCCTTCAATAACCTCATTCGGGAAATGGAGTAGCTGCCATGCAGTTCCACTTGAAGGTACATCCAAACGTCAAA
GATGCACCGGCATATTCGTCGCAAACCGTGCATTGTGTTTCTTGTGACCAGCCGGTCACGTCTGCAAGTTTTTTCGGGTAGGATTGTTCGAAGTAAAGGT
TTCAGGAACGCTTATCTATTGGTGATGTTTGAGTCATAAATACTGTCACCCTTTTTGAGTTTCAACGCGAGCTTTTCTTCCTCCAGTCTTCCTCTTCGTC
ATCAAACGAGCCCCACAAGTGTAATGAAAGAAACCCGCATTATATGGCGGCGTATGCGCAAGTTCACGTCGACATTCCAAGCCGAGTTGCGTGGGCACTA
CTCAACTGAACGAATGCACGATTTGCGCAAATACAGTCACTCAACATCATTGCAGCGCGCGATTTGGATCAGTGTGCTGTCGCCATTCCCTTGCCTTATA
ATTCTGACGCTGATTGATTGTGTCCGCTGGCCCCACCTGAAGACGGTTCCGCGCAAATTTCCTGTTCTGGGGTCGAGATTTCTTGACGATTGCTCTAATG
ACGCGTGTTATCTTGGAGCAGTTCCGGATAAGTGTACCGGAACTGCATATCAACTCTGTACAGGTTGTTGTAATGCCGATTTTAGCGAGTGGAGGCGCTA
TAGTATTTATGATCGCCATGTCAAGCATTATCGGATTTCCACTCCCGTTCGCACTTGTCGTGGGGATCTCGGTGTGGTTTGCGGTGCTGGTCGTGTGCTT
CGCACTGTTCTTCGGTCGAGTCCTGAAGCGAGACCCCGTGCTGTTCAAAGACTTGCTTAGGTCGATCGTAGTGCTTGTCTGTCAGGTGCTACTGACGTTC
GTGTATCCAGCGTATCTCTACGGATTCATAAGCGTTGAACCTTCAAACCAGAAGTTCTACGTCATGCTGCTTCCCATCATCAAAATTATCGCAAAGAACT
GGATCAGCTATTGCCTTGGCAGCAAACACGACCTAACACCACAGATCATGATCTTCAATGTCGACGTTTCAACGCGTTGTACGTCGCCAGCTCCATGCAG
AAGTCTCAATCGATTACTACAGTGCTGCAAATGGTGGCCCTTGATGCTCTTCTCGGCTGGGTATCTTTATCCGACATTGCTGATCTTGTGCGAGATGTCC
TCAGACTTCGACGTAAGATACCAATGGGACATCCACTGGAAAAGGCGAGCTTCATCGAAATTGCTCTCCAGATAATCGAAGAAGACCCTGACGTAGCTGA
GCGGCTAGCAATGCGTCACTACAGCTCTACAGCTCTAATCGTCAGGCGCTGACTGGTCCCAGTACGACTTCTGTGGCGCAACCTGAGGTCTTGTCTACCA
GTCGGCAAATTCTTCCGGTGGACGAAGCAAATATCTCACTCCCTACAGCTCCAGACTCAAAACCAGCATCGCTACGACTCGCTCCTGTGCAAAAAATCTC
TGGGCGATATTTTCTCGGCTAAGGAGCGTCACCGATTTGTGCAACAAAGCGCACGAGTACTTTTCACGACCGAGTTCGTCATTTTGGTTGAGTACACGGA
AGTGGTCGTCCCGTTCATCTACAGTGCGTCTTTGTTGCTTTGCTCCTCTAAAAGCTACAGACTCACCATGTTTTATTGTCTGACAGGCATGTACACAGCA
GGAATGTTTTACCTGCCCAACCGCGACTACTACCCCAACTCCAGTCGTTTGATCATAGCGGTTGGCAGTAACCTCGGAACCGTGATTGCATTTGGATTTA
TTGAGTTGATCTCTCTCTTGGTGATCGGATTCTTGATCCAACGGATGCTTGGAATCTCGACGCTGCAACTTCTTTCATTCGTGCTGGACCGGGGTTGGAG
AATGGTGCAGTCAAACTTGTTTCTGTGGATCTGCTACACGATTCAGAATTCGTTGGAACACAATGGTGCGTTGGCATTCGTAATTCTCTATACACTGAGT
TCCTCTAATTGTGCAATTCTTGTATTAGGTGCCGATTTCAGCTTTTCCTTCAGTTGGCTCGGCGTATCGGACACGGGGTCTACGTGACTCTTCACTTTTC
ATCGTTTTGGGGCGGCGGGCAGCATGGCAGCCAGAGGTGCGGTGACTTCGACCGTGACGCAGCTTACAACTGTTAGCCAAGTTCAAGATGCTGCTAGAGT
CTTGATGCAGACTCAAAGCTCCCGGCGGTCGTCCAAAGTCCCTGCACTACAGGGTCCGAAAAAGATCCTTTTGGTGGAGCAGCAGCTCGATAGCGAGTTT
GGTGCCGAGTTGTTCCCTTTGGTAGCGTTTCCAGCGGTGTCAGCGTCTTTGACGGTGCTCGATCTCTCTTTCAACGAGCTGGATGATCGATTTTGGATGA
ATTGGACAACGGAGCTGCACGGAGCAGTGTGGCCAGGACTGGTATCACTGAACCTTGCTAACAATCAGTACGTTGCCACTCAAACGTTTCTTAGCGAATG
ATATGCCGTTCACTTATTGATTCCTGTGTGGTAGGTTTTCAGCTCGTGGGCTCAAAGCAGTCGCGGCTTTCATCGCGCGATGCCCCAGCCTGACACAACT
CGACGTGTCACTCAATCTGTTCGGTGAACCGAATTCATCGTCCGATTGGATCCAACCACTGATCAGAGCGTTTGATGCCAAGAACCGTGAACCCCTTCAA
ATTCTGGACATGTCATGCACGGGTGTTACAGACGCGTGTTTCTCGCAGTTGATGGAAGCAGAATTCTCCAAGTATATTGCCAAGTTGTACCTCCGTTCAA
ATGCACTGACCGACAAAGGAGCAATCACCTTAGGACACGCACTGCCACTGATGAAGCTGGAGGTTCTTTCGCTTTCCGGCAACCTGATTGGAGACTGTGG
TGCTGCTAGCCTGGCGTTTGTATTGGATCAAGCACCAGCACTGCAAACCCTCGACCTTGAGCAGAACCAGGTATGAGGTTTTGTCTTTGCGGTCATGCAC
TGTTGAATAACTCTTGTACCTTGATGACCATGATGCAGATCGGACAAGCAGGGATCATGTCATTCTACCACGCGATTAA