Description :
From Genome Similarity Track
Location :
contig_14:854838- 856452
Transcript NameFunction/comments
g3678.t1XP_008907876.1 hypothetical protein PPTG_12904 [Phytophthora parasitica INRA-310
g3679.t1POM71162.1 Pectin lyase-8 [Phytophthora palmivora var. palmivora

Sequence
1614 bases(100 bases per row)
GGAACTCGCTGGTGAGCCTCCGTGACGGGAGGAACTGGCTGGGATCTGCTTCATTGTTTTGACGCCTAGTGCTACGTAGGTGCTGCGCTTTAGCAACGAG
AACTCGTACCTGAACTGGGCGAGGAACGGCGTGCTGTCCTCGGCCGTCGGAGTTGCAATGTACGCGCAGGAGCACCACCGCGGAGCTCAACTGAGTGGCG
CGGGTGAGTCTGCTACGTTGAGGAATGGCGCTTGCTGGTGGAGGATGCTGACCTCACTTTGTGTGCAATGGTGCGCAGGTCTGCTGCTGTTGGGCTTCGG
ATATATTGGCGTGGGCACGGCAAAGTATATTTATTACATTTTCCGCTTCCGCCACGTCATGGAGCTGTCCTGGGCAAGCGTCTTCGGAACGATTTCCCAT
GCGGCGTGGGGGTTGGCCATTTGGCTGACCGCTATTGCCTCCTTCTTGGTGCGTGGCCCGCGTTGTTGTTCACGGACGCATCCTTCCTGTGCTAACTGTC
AATTGTGTGCATGCGTCCTGTTTCCTATGCGAATGACAACAGGAGAGTGTGCCTCTCGAGCTGGATGCGATGCTGCTGACTGAGCCCATCGCGAGCTTCC
TGCCTTTCCGGATTCGTCAGGGTCTGATCGAGACGTACAGCCTCCACCTGGACGACCTCGAGCACCACAACGACGAGCAAGAGCGTGTGATGCGTGCGAT
TCGCGGCGACCGGGGGGCCCCAGCGATCCAAGAGGGCCAAGAGCTGCCTCCCCAGCTCGAAGCGCAGCTGATCGAGCAGCAGCTCCACACAGCACCGAGT
CCGGCGGTGGTGGGCTCCGTGCCTCCTTCCTCCTAAATCTTTCATGGCGGGTACGCAGTCCTTGTTGTTCTGCACGGTACTAATCCACGCGCGGTGCCTT
GCCAACTCCTCGTAGACAATTCTGATGTGCTAACGAAACACGGTGTCCATCTGAAGCTACATACTGTTTCATCCTGTTGTTTTGATTTGCCACATTGAGG
TCCTCAAGGCGTCTGTGCTGCTGCAATTCTCCCAGCTACCAAAGCCGCTCCGTCCCGTCCTGTCCTGCAGCTCTTAAGGCTTGAGCGCCTCCTCCACAGG
GATGTCGAAGTCCGGGTTACGGCGCACCGTCTTGCCGTCCCACGTGAGGTTGATGGGCTCGTAGGCGTCCTCGCCCTTGATGGCTTCAATGATGGGGGCG
GCCAAGATGATGTCGCTCTCGGGCGACTTGGGCAGCGTCAGGCCATGGTCCACGAGGCCCTTGAGTATCGAGAGGATCTCCTTGTCGCTCTTGCCGGGCA
CCGGCACCTTCTTCTCCACGCCCCAGTCGAACCGCGCGTACACGAACGGCTCCATCTCCTCAGCCTCGCGGTACACGAAGGGCGTGAGCGGGTTGAGCAT
CTTGAGCTCGTCGTAGTTCTTGCGGAAGAAGGTGCTGCATTGACACACAAAAGAACCACCGGAACGTCAGCACCTGATAGCGCAGGCCCCACGACGAAAC
ACGTGGTGAGAGAGCCACGGGACGCACCGCAAGCCCGCGCTGCTCTGCGAGGTGTCGCAGGCCACGAAGCGCAGCTCTTGGATGCTGCGGGAGATCTGCG
CGCGCCAACTCATG