Description :
From Genome Similarity Track
Location :
contig_14:854642- 856256
Transcript NameFunction/comments
g3094.t1hypothetical protein F442_11607
g3095.t1conserved hypothetical protein

Sequence
1614 bases(100 bases per row)
GGAACTCGCTGGTGAGCCTCCGTGACGGGAGGAACTGGCTGGGATCTGCTTCATTGTTTTGACGCCTAGTGCTACGTAGGTGCTGCGCTTTAGCAACGAG
AACTCGTACCTGAACTGGGCGAGGAACGGCGTGCTGTCCTCGGCCGTCGGAGTTGCAATGTACGCGCAGGAGCACCACCGCGGAGCTCAACTGAGTGGCG
CGGGTGAGTCTGCTACGTTGAGGAATGGCGCTTGCTGGTGGAGGATGCTGACCTCACTTTGTGTGCAATGGTGCGCAGGTCTGCTGCTGTTGGGCTTCGG
ATATATTGGCGTGGGCACGGCAAAGTATATTTATTACATTTTCCGCTTCCGCCACGTCATGGAGCTGTCCTGGGCAAGCGTCTTCGGAACGATTTCCCAT
GCGGCGTGGGGGTTGGCCATTTGGCTGACCGCTATTGCCTCCTTCTTGGTGCGTGGCCCGCGTTGTTGTTCACGGACGCATCCTTCCTGTGCTAACTGTC
AATTGTGTGCATGCGTCCTGTTTCCTATGCGAATGACAACAGGAGAGTGTGCCTCTCGAGCTGGATGCGATGCTGCTGACTGAGCCCATCGCGAGCTTCC
TGCCTTTCCGGATTCGTCAGGGTCTGATCGAGACGTACAGCCTCCACCTGGACGACCTCGAGCACCACAACGACGAGCAAGAGCGTGTGATGCGTGCGAT
TCGCGGCGACCGGGGGGCCCCAGCGATCCAAGAGGGCCAAGAGCTGCCTCCCCAGCTCGAAGCGCAGCTGATCGAGCAGCAGCTCCACACAGCACCGAGT
CCGGCGGTGGTGGGCTCCGTGCCTCCTTCCTCCTAAATCTTTCATGGCGGGTACGCAGTCCTTGTTGTTCTGCACGGTACTAATCCACGCGCGGTGCCTT
GCCAACTCCTCGTAGACAATTCTGATGTGCTAACGAAACACGGTGTCCATCTGAAGCTACATACTGTTTCATCCTGTTGTTTTGATTTGCCACATTGAGG
TCCTCAAGGCGTCTGTGCTGCTGCAATTCTCCCAGCTACCAAAGCCGCTCCGTCCCGTCCTGTCCTGCAGCTCTTAAGGCTTGAGCGCCTCCTCCACAGG
GATGTCGAAGTCCGGGTTACGGCGCACCGTCTTGCCGTCCCACGTGAGGTTGATGGGCTCGTAGGCGTCCTCGCCCTTGATGGCTTCAATGATGGGGGCG
GCCAAGATGATGTCGCTCTCGGGCGACTTGGGCAGCGTCAGGCCATGGTCCACGAGGCCCTTGAGTATCGAGAGGATCTCCTTGTCGCTCTTGCCGGGCA
CCGGCACCTTCTTCTCCACGCCCCAGTCGAACCGCGCGTACACGAACGGCTCCATCTCCTCAGCCTCGCGGTACACGAAGGGCGTGAGCGGGTTGAGCAT
CTTGAGCTCGTCGTAGTTCTTGCGGAAGAAGGTGCTGCATTGACACACAAAAGAACCACCGGAACGTCAGCACCTGATAGCGCAGGCCCCACGACGAAAC
ACGTGGTGAGAGAGCCACGGGACGCACCGCAAGCCCGCGCTGCTCTGCGAGGTGTCGCAGGCCACGAAGCGCAGCTCTTGGATGCTGCGGGAGATCTGCG
CGCGCCAACTCATG