Description :
From Genome Similarity Track
Location :
contig_14:854575- 856189
Transcript NameFunction/comments
g3854.t1XP_008907876.1 hypothetical protein PPTG_12904 [Phytophthora parasitica INRA-310
g3855.t1hypothetical protein

Sequence
1614 bases(100 bases per row)
GGAACTCGCTGGTGAGCCTCCGTGACGGGAGGAACTGGCTGGGATCTGCTTCATTGTTTTGACGCCTAGTGCTACGTAGGTGCTGCGCTTTAGCAACGAG
AACTCGTACCTGAACTGGGCGAGGAACGGCGTGCTGTCCTCGGCCGTCGGAGTTGCAATGTACGCGCAGGAGCACCACCGCGGAGCTCAACTGAGTGGCG
CGGGTGAGTCTGCTACGTTGAGGAATGGCGCTTGCTGGTGGAGGATGCTGACCTCACTTTGTGTGCAATGGTGCGCAGGTCTGCTGCTGTTGGGCTTCGG
ATATATTGGCGTGGGCACGGCAAAGTATATTTATTACATTTTCCGCTTCCGCCACGTCATGGAGCTGTCCTGGGCAAGCGTCTTCGGAACGATTTCCCAT
GCGGCGTGGGGGTTGGCCATTTGGCTGACCGCTATTGCCTCCTTCTTGGTGCGTGGCCCGCGTTGTTGTTCACGGACGCATCCTTCCTGTGCTAACTGTC
AATTGTGTGCATGCGTCCTGTTTCCTATGCGAATGACAACAGGAGAGTGTGCCTCTCGAGCTGGATGCGATGCTGCTGACTGAGCCCATCGCGAGCTTCC
TGCCTTTCCGGATTCGTCAGGGTCTGATCGAGACGTACAGCCTCCACCTGGACGACCTCGAGCACCACAACGACGAGCAAGAGCGTGTGATGCGTGCGAT
TCGCGGCGACCGGGGGGCCCCAGCGATCCAAGAGGGCCAAGAGCTGCCTCCCCAGCTCGAAGCGCAGCTGATCGAGCAGCAGCTCCACACAGCACCGAGT
CCGGCGGTGGTGGGCTCCGTGCCTCCTTCCTCCTAAATCTTTCATGGCGGGTACGCAGTCCTTGTTGTTCTGCACGGTACTAATCCACGCGCGGTGCCTT
GCCAACTCCTCGTAGACAATTCTGATGTGCTAACGAAACACGGTGTCCATCTGAAGCTACATACTGTTTCATCCTGTTGTTTTGATTTGCCACATTGAGG
TCCTCAAGGCGTCTGTGCTGCTGCAATTCTCCCAGCTACCAAAGCCGCTCCGTCCCGTCCTGTCCTGCAGCTCTTAAGGCTTGAGCGCCTCCTCCACAGG
GATGTCGAAGTCCGGGTTACGGCGCACCGTCTTGCCGTCCCACGTGAGGTTGATGGGCTCGTAGGCGTCCTCGCCCTTGATGGCTTCAATGATGGGGGCG
GCCAAGATGATGTCGCTCTCGGGCGACTTGGGCAGCGTCAGGCCATGGTCCACGAGGCCCTTGAGTATCGAGAGGATCTCCTTGTCGCTCTTGCCGGGCA
CCGGCACCTTCTTCTCCACGCCCCAGTCGAACCGCGCGTACACGAACGGCTCCATCTCCTCAGCCTCGCGGTACACGAAGGGCGTGAGCGGGTTGAGCAT
CTTGAGCTCGTCGTAGTTCTTGCGGAAGAAGGTGCTGCATTGACACACAAAAGAACCACCGGAACGTCAGCACCTGATAGCGCAGGCCCCACGACGAAAC
ACGTGGTGAGAGAGCCACGGGACGCACCGCAAGCCCGCGCTGCTCTGCGAGGTGTCGCAGGCCACGAAGCGCAGCTCTTGGATGCTGCGGGAGATCTGCG
CGCGCCAACTCATG