Description :
From Genome Similarity Track
Location :
Scaffold_1301:8545- 10089
Transcript NameFunction/comments
Phypl_g13049cysteine protease family C01A, putative

Sequence
1544 bases(100 bases per row)
CTGGGCATTCGTGGGGGTCTGGACAGCGTACATGGCCGAGttctgcttgcgcagcaccttgagcttcCGTTGTGAGACCACAATACCGATCGCCGTCGTG
ACCAGCGTGAAAATGGTGGTTGCAGCCGCCACACCGATCCACGCCGTTGGGCTAAGACCCACGAAGACCTTATCTCCACCGCTATCTACGGACGTGCTCG
CCTGGGCGCCGGCCTTCGCGCCGGTAGGAATCACGGGGAAGACATTCAAGCCGCAGTTAATTTTGgcgtccgccaccagcttgaTGAAGCCGCTGTCGCC
CCACGAGCTGCCGTACGAGTTCTTGAGGATCCAGTAGTCACCGACCGACGATTCCGTGCCATAACCCACGAGCAGGAGGGCGTGATTCAGGTCGTTCTTG
GACGCTATGTCGCCATTGTTTGGACAATTGTAGAACCCGCCGGTGTACTCACCAAAGCCGCCGTTAGAGGTAATTGCTACAGCAATGGGCTGCTTCTCTA
GTGCCGAGCGGAGTAACGTAGTGCAGTTCTTGGAGGCGGTACAGTCACCACCCACGATCTGCTCCCAACCAGTGATGCTCGCAGCCGCTTTATCCGCACT
AACAGCGCACACGGACGAAGAGTTCGATGCCGACGAGCTTCCGGAACTGGAGTCGTCGTACGGCATCGTGAGCTCGGTCACAAGACCCCAGCCGTTCTGA
GCAGCATCCATGAAGGCGCCGTGGGTCATGCCACCATTGCAACCACTATTTTGTGACTCCCACTTGATCTCCGGCTGCACCCAGCTGGCACCGTCCACTC
CGCCATCCGAAGCCCAGCAATACTCGAACGTTTGAGTAGTTTGAAGCGTACTACACGtcaggaactgctgcggAGACAAGGAGACGGCCGCCGAGGCGTT
TTCCGCGATCGCCACGGCCGTCTCGATcgcgtctgcagcaacgaACGACCAACAACTTCCGCAGCTCTTTTGGCTTTTCACTGGTGAGCACACGCTGTGG
CCCACGGCGTTGTCTGTGTCGCACCAGTTCCAGTATTCTGAGCTTCCCGAACTCgagatcgtgctgctgctgttggtacTGTTTGCttgctggagacggc
gagAGTAAGCTGAGACCACTTCCTGATCCACGAACTGCTCTGGCGTCACTTTGCGGATAGGCGACGAGGTCAAGTGGCGTTCGTTCACACCCATGTGATA
CGAGAATGCGTGGCCAACTTGCTTCGCGTACATGTTCACATCTGCGTGGCCGCAAGAACAACTCGTGTTAGTATGACGCAATGAACTCGCCAATGAACGT
CTGCCGTCTCACCTTCGATGTACGTCATGTGCTCCTGCAAGTTGCGTCCGTACGACTCCCTGTCGCTGTAAGTCACGTAGTTGCGCTCGATGAAAAGCTC
GCGCAGTGTTCGCGAATCAACGACGTGGCCATTCTCTCCGGCCCATAGGCACGCCGAGTCTGCAGAGCGAACAGTAGGACAGCCCACGAGAGAACCCAGT
GATCTGTCCGTGGTCTGAACCGCGGCAGCGTTAGCAAATACCAC