Description :
From Genome Similarity Track
Location :
Scaffold_1203:8545- 9711
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1203-snap-gene-0.5Myosin

Sequence
1166 bases(100 bases per row)
CCCGGTGGTTGCGAAGATATGATCGAACTCAACCATCTCCACGAGGCCGCGATTCTCTACAACCTCAAGCGCCGCTTCAAGGCGCGCCTGCCCTACACGT
TCACGGGCGAGATCTGCCTCGCGCTGAACCCGTACCAGTGGCTCTCGGAATTGTACACGAGCGATCTCCACACCAAGTACCTGAATGCGGCGTCACGGAA
GCAGCTGCCCCCGCACGTTTACGCCGTGTCGGTCGCGGCCTACAAGCACATGACGTCCCAGGCAGAGAACCAGAGCATTCTCGTAAGCGGCGAGTCCGGC
GCGGGCAAGACCGAAACGACCAAGATCCTCATGGACAACCTCGCGAGCATTTCCAACACGACGGGCGCGTCGGCGCAGCACGCGTCGACGATCCAACGCA
TCTTGGATGTGAACCCACTGCTCGAGAGCTTTGGCAATGCCAAGACCAAGCGCAACGACANNNNNNNNNNGCAGTTCCAAAAGACCAAGGGAAAGATGGT
GCTGTGCGGTGCCAAGTGCGAGACGTACTTGCTTGAAAAGACCCGCGTGGTGACGCAGGAAAAGGGCGAACGCAACTACCACATTTTCTACCAACTCGTG
CATGGCACGACCGCCGAGGAAAAGGCCCAGTGGGGGCTCGACGGCGGCAGCGACGAGATAACTGGGTTTACCTACATTGAAGACGACGATCTGCACTTGC
GTGACAAGGACGCTCGCAATTACGGCAAGACCAAGCACGCGCTCGGGCTTTTGGGGCTTGGTGATGCTGAACAGGAAGCACTGTTCCAGACGCTCGCCGG
AGTTCTGCATCTCGGCCAGGCGGCGTTCGAGGCCGACAACTCGAACGAAGACGGCAGCCACGTCGCGGAGGACTCGACGCTGATCGCCGCTGAACTACTT
GGCCTCCAAACCCCGAACATGGAGAAGGCGCTGTGCACCCGTACCATGAAAGCCGGCGGCGACGTCTACTCGGTGCCGCTGAGCGTCGCGCAGGCCACGT
CCAGTCGCGATGCACTTGCCAAGGCGATCTACTCGAAGATTTTCGACTGGATGGTCGTGCAAATCAACCAGAGCCTGAGTGCCCCCGAAAGCGACGTCAA
ACACACGATCGGCGTGCTCGACATTTTCGGTTTTGAGAGTTTTGTGCACAACTCGTTCGAGCAGCT