Description :
From Genome Similarity Track
Location :
Scaffold_334:8544- 11933
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_334-snap-gene-0.15Protein kinase
Pytul_var.sporangiiferummaker-pug3_contig_334-snap-gene-0.16Protein kinase
Pytul_var.sporangiiferummaker-pug3_contig_334-fgenesh-gene-0.10Gene of unknown function

Sequence
3389 bases(100 bases per row)
AAATAGTACAATAGTAGTCACCAATTAATTAATAAAATTTGCGCTAGCTTAAAGAAAGGGTTACGAGGCCGATGTGACATGGGTGACCTTTGTCCTATCT
CAGTATGGTGCCCCTCGCACTGCGCTTTGTAAGGCGGTTAACTAGCGTGGACGACTCAAATTGAAGAAAGCCCGAGCAGCGCGACAACTGCACGATGAGC
AAACCCGCACTGGCGTCTCTTGCGCGCAGCGCTACTGCTGCTACTGCTGCTCGCATCACCAATCTGCCGTCTCGACACGCTCTGCGAGCAGCTACGTTTG
CAGCTGGTGGTGCCAATGGAGCAACGTTGAAGGTGGCACAGCGAGGCGGTGACGGTGATGAGAGCACAACTAAGCGACTCGCTGCACTTGCGCTGGCGTC
GGCTGCGCTGGGACTTGCATGCGGAGCGAGTGCGCTGGAGCGTGATGACGTTGAGGCGCAATGTGAGAGTGCACAAACGTTGCTGCGCGCCCCAAAAGAT
ACGCGTGGTCACTATGCGCTGTTCAATGAGTTAGGACGAGGAGGTACGTTCACACTCTCCGTTGATTCCGGTGGTGCATGGCTGGCATCGGTCTAATATT
GCGGCTTTCTATATGTGGACGCTTAGGATTCTCGATTGTGCGACTTGCCCTTGATATGGACACCGATCAGGTACGGATCCTTGCTCCGTAGGCATATGTG
AAATGTATCTAACGCGACCATCTCTGCGTAGTTGCTCGCCGCCAAGATCTTTGATCCAAAGTACTGCTCCACTCAGGACATTCGCGATGAGGTACGAAAA
GGTTTTTGCATATTTGAGCTGGGGCGATATGGACTACCACGGCGAGGCTCCTGGTGTTACGAATGCCTGGTGCGATTATGAACTATAACAGATCGACACG
CTCCGTCATTTGGGCAAACACCCCAACATCGTGTCGCTGCATGACGTGCTCTACCTCAAGGACGAGACGATCATGTTCATGGATCTAGTGCAAGGCGGCG
AGCTTTTTGACTACATCGTAGACATGGTGAGCGACTTGCCGAGATCGACGATGCTTCAATAAATGTGATACTCACGCAAACCTCACGTTATATGTAGGGC
TCGATCTCCGAGAAGGACGCCAGCCGCATGCTTCGTGATGCGTGTCGAGCGCTCGAGTACATGCACTCGCTCGGCATTTGGTACGACGTGCAACAATGTC
ACTCATTGCAATGCATGACGAGAAAAACTCACTTGCATTATGTGTGACACCAGCCATCGCGATCTCAAACCGGAGAACCTGCTGTTGACGACCCGATCCC
CGGAAGCAGACATCAAAGTTGCGGTAATGACGACGCAGGATGGCTACATGTCGATATGAACGAAATCGGACTTTCACGTATCTGGTTGTTTGTTAAAATG
CGTAGGACTTTGGTATGAGTCGCCGGCAGCGGAAAGGAGAGAAAGTGCTAGAAACCCAACCCAGCGGAACCATGTGCGTAACGTGCGACAGGTATCTCGA
CGACAAAGCAAAGGGCGATTGTTCTAATGTGGTTGAGCTTTGTGCTGCTTGTGTAGTGCGTACTGGTCGCCAGAGATTATCAAACGGCAACCACAGGATT
TTGGAGTCGACATGTGGGCTTTTGGGGTGCTGGTGAGGGTTGCAGAATACTTGTATCGTCCTTCATCGTGCGTGGAAGAACGTGTTTACTGATAGTTTGC
ACGTTGGAATGCATTCCTGTAGGCGTACATTACGCTCACAGGTGTCCACCCATTTGACCCAAAGGGCGACCAATCCGATGCGGAAATCGTGCGTGCGATT
GCAAAGGGAGAATATGATGGTGCGTCGTTCATCCATTCCCTCGTATTCGTATAGAACATACCTCACAAAAATGCTTCTCCCTTCACTTTGCAACCTTTTT
AGTGAAGAATCCGTGGTATCGAGATCTCTCCAATGAGGCGAAAGATTTTGTCGCAAAGCTGCTTCAGTCGGATCCATCGAAGCGCTTGACGGCCAAGGAT
GCGCTCGCGCACACGTGGCTTAAAGGGAAGATGGTCTCTACTGAGCCGCTTGCGGTTGGCCATACCGAGCGCTTGCTGGCGTTCCAGCGTCTGCAACATC
TTCGCGCGAATATCTTGGCCGTCATCATGGGGGTTCAGCACTCGAAGTTGGCACAGGCTGCGACGACAGACAGGACGCAAAGCGAAGATGATTCCTCTCA
CGTCCCAGCACGCACAACCACCGTCAACATGGACATGTTCAAAGACACGTTTGCGCTCTTCGACAAGGATGAGTCTGGGGGCATCGATCGCGACGAACTA
GAAGCCGCAATGTGCGCGCTCGGACAACGGCTCTCCAGGTATGTACGCGCCCATGATAAATGAAGTGCGATGCTCGCTATGTGGTGGTGATCAAAATGGT
GATGACGGCCATAACGTCTGGTGTTATACGGTGTGGTACAGGTCCGAGCTCGACGCGATCATGCAGCAAGCCGATTCCGACGGCGATGGGAAAATCTCGT
TTCTAGAGTTCGCGAGTATGATGAACCAGCGCTTGTTTCGTCAGTACGTATTGTTGCTGCGGTTGCCGAGATGCGACTCCAAGTTCAAAGCATCTAAATG
ATTTTACGTATGTTGCACATCAGGGGTGAACTAACCGAAGCCGATCTGAAATCCGCGTTCGACGTGAGTCGCCCTCATGACAATTTCCACCTGATCTTTG
GGTTTCAGAGCTAATATCTCTCTTTCTCTTGTTGGGGTGGGGATTCCTAATAGATCTACGACACGAACCACGACGGTTTCATCTCGAGCTCCGAGCTGGC
GTACATGCTGCACCTCCTGGGCAAGCACACGTTTACGGACGAGGACGTCGCGAGCATCATCGACGTGGCCGACACGAACCACGATGGCCAAATTGATTAC
GCCGAGTTTTGCCAACTCATGCGCCACGTTGGAGCGAAACGGGATGCCGGCAGTGGGTCTCCTTGAGAAGGACACTTTTCTTCAAAAACTGCGTTTAATG
TGGACACAGATCGAAGAAATGTCGTGTCCACCAGGTTTATGTGTAACTAACGCAAAAATGATCATGGATTGTTTAACCACCATTCAGCAGCCGCTCTAGC
AGTAGTAATAGCCTTTGTAGACGCAGCCATAGCCACAGCTCGAGCCATAGTACTTGCGGCCGTACATGTTCCAGTAGCTGATCTGGTAGCACCATCCATA
GCGGTATCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGTAAAAGCGGTACCGATAGACGCTTCCGTCGCTTCATGCAAAGTCGACGTCGTCAGCTTCGTCTAAACCCAGTACCCCCTT