Description :
From Genome Similarity Track
Location :
Scaffold_622:854- 3768
Sequence
2914 bases(100 bases per row)
CCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTAAGGACCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCTGAGC
ACGGAAAGTCAGACGTGGAAAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTT
TAGCGCGGAGGAAATACCTTTCCTCGGGTGCTTCATTGGGAAGCGAGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCC
AAGAACCAAAAGGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCAACCTACGCGGAGATGGCTCGGCCATTATCAGATCTCC
TTAAGACGGACGCACCATGGTGCTGGAACGTCGGGCACGACGTAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGA
CCCGGATAGTCCGTTTATCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGTTTTACTACAAGCAGACGCCGAAGGGCGTGAACTCGTGATCGCG
TTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACC
TGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTC
CTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCAT
GTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGT
TTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCAAGGCTGCATCGATACTCACTCGATCGCGGCCTGCTGTACTACAGCACCGACTCTGAGGA
TAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAG
ACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCG
CGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGC
AGGAAACACGGGTATTGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTG
TTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGGACGTCCCTCTTCAG
AGTGCTTGGCACTCGTTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACAGAACGCGTGAATCGCGTTGTGGGAGGATATCCTCCGAA
GCGTATGCGCTGGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTCGAGTTCGCATTAAATAATGCAGTGCACGCGTCGACAGCTACACTCCGCT
CTATGTGAACGGCTTGGTTATTCCCTCGCGTCCCACTGACGCCGCCACGCAGGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATG
TCAGCCCTGTTGCGGTTCGAAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGTGACGCTATGGCGAAAGGCCAAGACAC
GCAAAAGGAACATGCAGATGCCGAGGATGAAAGCAATGTGGAGAGGTTGGAGGTAGGAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTGTGAGTCAGCAGTGGTGGCTCTAACCTATCACAAGGTGGATCATCTCTTCGAGATCGACCGATGGGCGGTGAACGTGAACGTTCGCGTCGTGG
ACGCCGGCGTCGTATGGACGCAAACGCCGTTCCGGCAAGTGCTGACTCTCCCCGCGAGATCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAG
CATGGTGAGCTCCACGTTCACGTGGAACGCCTTGTGGCGTGGCGTAGGCGCCAGGGTCGTACCCAGTACTTAGTGTAGTGGAGGGGTTACCCTCACTCAC
AGAACTCATGGGAG