Description :
From Genome Similarity Track
Location :
Scaffold_1752:854- 2973
Sequence
2119 bases(100 bases per row)
GAAGCACATGACTCGTCAGGTAGTCTGCGGAGCTGTTGAACTCTCTTTTGACGTGTATCAGCTGGATTTTTGAGAACCTGGTGGCCAATTCCTCGTACCG
CCTAAGCAGCCGCTGCAGGTTTACAGTGTTGCAGTTGATGAGACCTTGTGCTTGCTGGATGGCGATCCGAGAATCGCTGACGACGGCGATTTCCTTGATC
TGACGGTTGATAGCAAGCTGGAGTCCAGACAACATACCATGGTACTCGACTTCGTTCACAGTGACGTTTTCGAGATGAACGCCCCTGGCTTTGGCGATGT
CCCATTCTGGTAACTTCCACAGAACGAAGCCTGCGCTCCCCTGGCTGGACTTGAGCTTGGCAGCACCGTCAAAACTGACGAGGTACCCGTCATAATCATC
TTCGAGCATCTCCAGACTGATTGGTGGGGCTTTGATGCGCGCACCTTTCAGAGGGATAAGCTGACCTGCAATCTGGTCTAGCTGATCGCGGGGGGAGATG
CTGGCGGCCAAGACGGCGGCCAGACCGTCTTCATCCTTAGTCAGCTGGTGCACCTCGAGTGACCACGGTGACAACAAGACTGCCCATTGCAAAGCCCGGC
CTTGTAGCGACTTGGATCGCAGCAGCCACTTGAGCGTCGAGTATCTGGTATACACCTGGATATGTTGACCTGCAACTAGAATGTAGAGCACACTTAGAAC
GCGTAGCAGGGCCAGCGCCTCTTTTTCAGCTTTGTGATACCGCAATTCTGCGTCGTGGAGTATGCGGCCAGTGTAGCGGATCGGACGGACGACTCCGTCG
TGCTCCTGGCCGAGCACGGCGCTCACGGCCCATGGGTTTGCGTGGATGATGATCACGAACGGCTTCGACCGATCTGGATGACGCAAAAGGGGTGTGCTAG
CAATCTTCTCCTTCAAGATGGCGAACGACCTACGAGCTCGATCTAGGTCGCGCCCCAGGCGGATCTGGTCGTCGCTCAGCTCGTACAAGACGGATGCGAG
GACGGAGAAGTCTTCGATGAACTTATGGTAGTAATTCAGACTCCCCAGGAACGACTGGATGCCTTTCAGCGTCTTTGGAAACTCCAGATTGGCCAGACTT
TTTAGAATTTTTGGTGTAGCTCCGATGCCTTCACGACTGACGGTGTGCGACAAATATGTGGTCTGGCGCTTGCTAAACGAGCTCTTGGGCAAGCTGACGG
AGATACCCCAGTACCGAAGTCGATACAGCAATTCATCCAAGACTGTGCACAGCTTGTCCCAGCTCTCGACGCCGCACGCGATGCCATCGATATACGAGCT
CCGGCCGAGGACTGGACCCATCTGAGGTGGTGCGTTTCGACCGGACTCGTAGACTGTTGGAGGCGTCAATCTGGGTCGGTCGCTCTCGCCACATACATTC
GAGAGAGTATCCAGGCGATCCGAAAGCTCCGCCGAGACATCTGGCTCAACCAGCTTGGGGTCGGAGTTCGCCTCGGTCTCGGGAGCCAATCGGAGAAAAT
CCAGGACATCTGGGTCGACAGTTTGCTCTTCTGCGGTCGAGAGTCGCTTGAAGCCCCAAAGGGTGTTGTCTAGACACTTCTGGTAGATCAGAGGAGCGTT
TTTAAGCCCAAACGGCATACGCAGCCACTGAAAATGACCCAGAGGGCAGATGAAGGCCGAGATCAGCCTGGCACGCAACGTCATGGGGATCGCCCGAAGC
CGGACGCCATATCTAGGCTGAGAAATCACCTGACTGAATCAAAATTGTCCAGAAGCTCATCGATGAGAGGAAGCGGATAGTTCATCAGCTTGGTCAGCAG
ATTCACAGCTCGATAGTCAATGCAGAGTCGGATATCTGCACCGTTCTTTTTCAGCACAATGACGATGGGCGACGCCCATTCAGACGACGAATACTCGATG
AGTCCGGCTTCAAGCAGGCGCTTCAGAAGCTCGTACACCTTGGCGAGCAAGTGACCAGGAATCCATCGGGCACACTGGGCGACGGGCTTTGCGTCACCAA
CGTCGATGTCACAGATCGTTTCGCGCGCAGGCGGCGGGAGAGCATTGCCATGTCCGATAAAAACAGTCTCGTGTCGATGCAAGATGGCCTTGAGGCGAGC
TAATTCTTCCGGGGTATTC