Description :
From Genome Similarity Track
Location :
Scaffold_1491:854- 2167
Transcript NameFunction/comments
Phyta_totarag13110hypothetical protein

Sequence
1313 bases(100 bases per row)
GACCTCGCACTCACCGGCTAGTCAGTCTGGTTCCCAACTATCTTCAGGCAAGAGTTCTTCGTCGAAGTCTGAACGCGAGTCCTCAGTCACATCTTGCGTC
AACCGAGTCTTCGGTCTGTCCTCAAACTTATTTACCATCTTCAGGTGTGACACGTGCACCACGGGGTAGAAGCGGTAACTACTCCTGTCGGGAAATTCCA
GCTTATAGGCGTACTCTTCCACCTTTTTCCTTGACACGGAACGGACCGTGTCATCGGTGGGCAAGCTTCTTGGTCAAACCCGGCTTGACTCGCTCCATGT
ACAGCCAGACTCGACTTCCAGGCTCAAAAAGAGATTTCGTCATCGCTTCGGTAGGTTCATCATCAGTGTGCTCGTCATTTTGGTGGTCGACCGCAGCCTC
ATCGCTTAATTGTCGAGGCACAGCTGTCCGCTCCTTCCGACCCAAGGCCTCATTGTGTTCCTTGGCTCGGCGAGCCTTCTTAGCGGCTTGGTACTCCTTG
GCCATCTCGAGAGCTATCTCCTGTTGACGGTTGACTTCACGACGCCACGCCAGTGCATCTAATTGCTTACCAGACCTGACGAGGTCATTGCTTGCAACGT
GGAGTGAGCGTCCCACTCACGTACCAGGTAGAACGAGGTTTCTTTTCGCGTCGTGTCCTGAGAATTGTAGATCGCAAACACCAGTCGTTCTGCGATCTCG
TCCCAGTCCTGCTGCATCGGATCTTAGACGTACACCTTTTCACGGACTGCATAACCGTCTTCACCGACCTTTCCTGCTGTCCACTAGCTTGAGGTCGGTA
GCTCAGCGTCGCCCTTGACCTTGACTGTATCATTTCGGTAAAGGCATGGATGACCTCGCTCATAAAGCGGGGATCTCGGTCGTGTCGAAATAGTGACGGC
GCCCCAAAACGTCGGTATATACACTCTTCAAACGCTTGAGCCACCATGAAAGAAGATGTATCTGACATGGTCTTCGCGAGGACAAATCCAGTGAACGAGC
ATTgaaacaacaacaacaccgtGTTACCGCGTCGAGACTTAGGTAACGGTATAACGAAATCTATGGACACTATTTGGAATGGTCGTTCGGCAAGAATGGT
GTCAGGCGAGTATCCCCGGAGCTGCGGTCGGCTCTTGCTCGAACTGCAGTCAGGGAACGACTTCACATGCTTCGCCACGTTAGCGATTAAACCTAGCCAG
TAGTAATTCAGCTTCACCCGTTGGTATGTCCGAACTACACCTTGGTGTCCACCTTCCAACGAGTCGTGACAGTTCTGCAATACTTCTTGAATCATTGTTG
CTGGTACCACTAG