Description :
From Genome Similarity Track
Location :
Scaffold_610:854- 2158
Transcript NameFunction/comments
Phyag_g6993hypothetical protein PHYSODRAFT_378594
Phyag_g6994hypothetical protein PHYSODRAFT_478586

Sequence
1304 bases(100 bases per row)
TTACGATTTAGGCACAGACCTCTCTTCTCAGCCTTGTCTACCCAATCCCCCAGTCTTTTTTCGAGAGTAGGAGCCCGTACCTTTAGCGGTTTACGTCTCT
TACCTATTCGTACTCGTCCTTCATAATTGCGCTAGCGTTCTTGAGAATATCGGACGCTGTGTTGCGCGCAGGGGCCTTGGACAAGCGGAACATCCTTTCT
TCCGCCGCGATTACCATTCCAAAAGATTGTGCTGATTGAGCCAGCTCTTGAAACGGTACTGTAGTGCAGCAAGACGATTTCCCAAGCCGCTCTTGCAAAC
CTTCGGCAGTGTTGAGACACCTCTGGCTTCAGCAGTGTCCGGTAGCGCAATTGCAGACGTGTTGCAGGGCTAGCCAGCCGCAGACAGGTCCCCACACGCG
CACAATCGCGATCGTTCCcactcgtcgctgtcgctcgagCCGAGTCCCATGGCATCACCGCGTTGTAAAGCTTTGCTATGCTGAAACTTCAGTCGTAGGT
GAACAAGTTGGGGAACGACACGACAAACTATGCTTCTCTTTTCCTTTATGGATTTCAAAAATGCTTCACAATAGCCTCATACCAAATTCGACGGTGGGTT
CGAGCGCGGCGCTCCAACGGAGATCGTTGCCGTCGTTTTGCTCTCGAATTCCCGAAAGTCTTCCAAAATGCGCAGCAGGTCCTGCTGCACTTGCGTGCTG
CTCGGCCTGTACTTGGGTTTGTAGCTGGTGCACGCGTTCACGAGCTTGACGATGCTCTTCGGGCACGCAGGAGACAGCGTAGGTGACAGTGCACCCCTAG
CAATCAGCTGCAGGATGTCTGTTTCAGGTACAGCTGCGCGGTTCGCCTGCATCAAGTCCGAAAACGGCAGCTCGTGCGAGTCCATCTCGGCGATCAAGAT
TCCAAACGAGTACACGTCACTAGCGTCCGGGTACGATGCGCTAGTCTCGCGACCTAGAAGCGCCTCGGGTGAAATCCAACGGCCCGATCCCACAGCACTG
TACGACATGAGCTCCTGCTCAGTAAGACCATCAGAACGACCATCCACGCCAAAATCGCTCAACTTGGCGCGCAGTGACTGATCCAACAGCACATTCCTCG
AGTTGCAGTTGCCGTGCACGAGCCGTGGGTGCATTGAGTGAAGGTAGAGCAGAGCCCTGctcacatccagcagcatctgcactTTTTGGACGGACCACCT
GCCACCTTGTTTGTGTGCCGTACGATGGAGCCACTGCCGCAGATCGCCTTGGGCCATGTACTcagtgacagcgacgaggtgTGTTTCGCGGGACCAGGCT
ACCC