Description :
From Genome Similarity Track
Location :
Scaffold_749:8538- 11402
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_749-fgenesh-gene-0.1Protein prenyltransferase alpha subunit
Pytir_DAOMBR486maker-pir_contig_749-fgenesh-gene-0.4Deoxyhypusine hydroxylase

Sequence
2864 bases(100 bases per row)
GGCGAAAGAGGAGCATGAGCGAGCGCTTGCGGCTGTGGGTGCCGTGCGCCAGCAGCTGGAAACCGCGCGTGCAGAGTACGCGGACGCCCACCAGATGGAG
CTGCAGATGGAGCAGGATCTGCAGAGCGCGACCGCGAAAGTGGCAGCGGGGCTTGAGGAGATGCACTTGGGTGCGTTAAGCAAGAATAACGATGCAAGCG
CAACGTCAACCAGTGCGGAAGTTGAAGCGACCAGTACTGATGCTGTAGAGGGCGAGCGAGCTGCTGCTACGGTGCCAGCCATTGGTGGCTTTCTGGTGGA
GTACCATCGCAACATTGGCTGCTACCTCTGCTATCTGTTCATCGAAGATGGCAGCAAGTATGACCAAGTGAATGCAAAGCAGCTCGCGATCCAAGTCGAT
TTCCCGGCAGTAAAGCTGTTCGTCAACAAGCAAGGCAGAAATGTTGAGGACTCAACTTCTGATGACAAGGATGGTGCTGATACAATGGAAGAGCAGCTTT
GGTGGTCGACCGAGATTGAGCGCAATGTGGACCAAGCAAAGTGCGTGATCGACGTCAAGGTATGGAGGATGTTGTATTAGCCATTGTAGTACGCACATCG
CCATTGCTCATCTTGTATTGCACTTGGTGCTGATAGGCGGACCACATTTACTTGCGACTGCCGGTGAAAGAGGGCGACAAGGACGTCGCGGGCGATGGCT
TCTCGTCGTTCAGCCAGATCACCTCGAACGAGCTCGCCAAGAGCCATTATAGCAACATCGTGTGCCGCGCGTGTGACAACGTGTTGGCGCGAGCGACTGC
TGCGAATCCGATTGAGAGAGTGCTGCCGCTTCCGTCGGCGAATTGGATGGACATGTTTGACTTTTGGGGGGCGGGGCTCGGCGCTTTCGAGCACTTGCCG
CGAGAAGACATCTTCGCCCAGAAGGCTCGCGTGTACGTCGGAGAGTCGCACATTTTGCTGCATGAGGACAACACGATGTCCGAGGCACTTGCAACCGTTC
CAGTCTCTACGACTGCTACTATTCCTGCGAATGGAAAGCGAGAAGGCGCCAGCGAAGAGGAGGAAGACTCAAAGAACTTCTGGCAGCCTCTTCAGTGCTC
GAAATGCACTGCCGCACTTGGCATGCGACACACAGAGAACGTGCAGACCATTCGACTCGACAAGCACTTGATCGCATCAAAGAGCGCCAGTGCTGCTGCT
ACGAATGGATCTCCACCAGCTGCGAGCGGGATGACAGAGACGGACATTTTCGCACGGTACACAGTCGACAGTGTCGTGTGCACCAAGCTTCTTGAGTTTG
CCGACTCGGACGGCGTGTTCCGGTTCACATTGCGCTCGTCAGCTGATCAAGTGGCTCTTCAACTCCAGCTGCTGAGCTGGGAGATGCTGATCAAGGTCAA
GAGCTCGCCCAGTGAGTTCCGCAGAGTGCTCAAGGTGGTTTATGCGTCTTCTCCTCAAGCCCAGACGACAGCGAGCCCCTTGCCGGTCGCACCAGCTCAA
GATCTGGTCTTTGCGCCAGCAGTCTGTGACGCTGTCGCCTCTCGCCTGCGGACAAGCTCAACGTTGCTGCCTGCGTCTCTGCGGAGATTCAACAAGATGG
ATGTTGGCTATCTGTACGCGTAGTCGGTCAGCAGAGAGGCTGATTGAACAGTATCAACTGATAGTATAGAAACCCAGGTCATTCGCAAACAAAAATCAAG
ATCTACTTGTAATTATCAACGGTGCAAAATAATATGAAAACAAGGTCGATATGTGGGTCCTCCTCTTCTGTGATGTTCTACGAATGAGTGCGCTTTTGGG
TTTACTTGGTCGGCGCCCAGTAGTCGATGATGTCTAGTGCCACCTCGCAGCTCTCGCGCACGACCTGCTCCGAGTCCTTGAGGTAGACCTGCAGGATCTC
TTCGCACTCGGGCGTGCCGATCGCGCCGAGCGCCTCGGCGGCTTCATGGCGCACCATGCGGTGCTCGTTGTGGTCCATCAGCACTTTCTTGAGCGACGGC
ACGGTCACCGGGTTCTCCATTTGGCCCATCACGTACGCGACCTCGTGGCGGAAAAGCGCGCTCGAGTCGTTGTAGCCCTCGGCGAGCGCGAGCGCCGCAT
CCGGGGTGTTGCGGTTGCGCAGCGAGAACATCGCGCGGTAGCGGTCAAAGAGCGGCTTGGTTGGATCCAACAGCGTCGCCTTGAGCGTTTCAGTCGGCAC
GTCCTTGCTGGTGGCAGGCGCAGGGTCCACCGATAGGTACGGGTTGCGGTCGTGCTCACCCTCGACGATCGTACCCTGCGCCTTCTCGAGCTTGTACTTG
ACCAGGCGTAGCGCCAACTCGCAGGTCTCCGAGACCTCAGGCGCAGGGTCCTTGGCGAACTTCTCCAGCACTGGGATTGACTGCTCGTGGCCGATGGCGC
CGAGCGCTTCCGCAGCCTCGTGGCGCACCATGCAGTCGTCCTCCACGTCCTCGACGATGGTCTGAAGCGTCTCGCAGGCGTCGGCGTCCTGGAACTGGCC
GATCACGTACGCCAATTCGTGGCGCATCAGCTCCGAGTCCTTCTTGTTCAACAGGGCTGCGCAACAAGCATCAAAAGAGGCACAACAAGGTTAGCATACA
TGTTATTGAAGCAGGTTCAATCGCAATGGCAGACGCCAGCATAACGCTATCGCCAGCTTTGTACAATCAAGACCAAATCATTGTACGTAGCAACCAGCAG
TCGCAATGGCTCCTGTACCTGTGAGCAGCACCTGGAGGTCCTCCTTCTGGCCGCGCGAGCGCAGGTAGAACACGGCGCGCGTGCGCTTGCCCATGGGCTG
GCTCAGGTCGAGCAGCGACTCGGCCAGCGCGTCAAAGGTCGGGACGGTCTCGGAAGCAGTCATC