Description :
From Genome Similarity Track
Location :
Scaffold_1058:8538- 9779
Sequence
1241 bases(100 bases per row)
CGTATCTTACGCGACGTTTTAGTCAAGTCAGTGACCCCCATTGAAAGTTTGTGATGGAGCTCGTAGGAGAGCTCATGAATGGGCAATGGGCAAACGCGCC
AAATGAAGGGCGGATGCATTACAACGGGGAGATGCTTGAGGAGGCAGAAGTGGGACATATCGACACGCCTTCATCTCAGCGACCGGTACTTAAAGACGGA
ATGGCGgtgactacatgtacctcggTGGCCTCCAGACAAATTCATGCTGATAAAAGCTGAAAACGCCGCCGTTGTATTGTGTGCAGGTGGGAGGGAAGAT
ATCCGACTGAAGTTACAAATTACTGCCTCACATACGGAGCGTGTTTGTGTTTATGCCGAGTAgtccacgaccagcaggCTAAACCCTAGATGTGttcgtc
caccacgtcaACATGCTGGGATAAATTCCACATGTTCTATTATCCCAATGAACTGGTAAAGGTAACGTGCGGAGTCACTCAAATCTCGCCAAGAAAAAAG
CTGAAGATAACAGTCAAGACTCTCGGCCGACTGATGTTCGCCAAATTCAAATATAGTCACGGACTATGTCCGTGCTGTATCTCGCGGGACGATAACAATG
GTGTTGATCAAGGTGTGGGGTGGCGCTCAcggacatggtgctgctgctgcttacAAGACcgaggaggtgctgctgctcccgaAGACTTGCggtgaagctg
ctcatgCCTACCCTGTTATGGAGGTAGCagtggcggtgctggtggtggtggtggtactCGTGAAGGCGGCGGATGCGAGATGGCGTTTCAGCTCTcgacg
gaggtggtgctgaTCGTGTAGAtggcggagacgctgcgctTGGCTAGGCTGGTGTGGTGAgggtggtgatggtggcggGTGCTGCTAGAGGACacggcgg
aggtggtgctgaTCACGAATAcggcggtggagctgcttgtACGACTTCAAGCCGGCCTATGAATGTTCTGTACATTATCCATGTAAAATATGTGTACTTG
TGTTACTAAAGTTTTTTGTGGTAGATAAAAATAGGATGTAGAGCCGACTTCCAGTTATTCGACAAATTTATCTCACGCACTAACTCCCAGCGCATGCAAT
ATGGCTCTAAGCGCGTTGAGCGATGTCTTGGACAAAaccgtgatgttgctgcaactaGTCGTGCTCTTGGCATAACGCTAAGATCTCGAGAGATAACCAT
CTtggcatcttcttcaaaaATAAAGAAGATAGCGAATTCAA