Description :
From Genome Similarity Track
Location :
contig_93:85366- 86376
Transcript NameFunction/comments
g12700.t1XP_009525659.1 putative endo-1,3-beta-glucanase [Phytophthora sojae

Sequence
1010 bases(100 bases per row)
TCCAGCGTGTCGATGTGGTGGACCTGGGCGTAGTGCAGCAAACCGTTTCCACAGTCGCCGCTGGTCTTCCACACGTACGCGTAGGCGTCTTCATTGTGGG
CTTCAACACGGCCACCGTCGAGGACGCAGCCCGCCGTCTGGTCGAAGACGTTCTGCTCTTGCGCAGAGGCATCGGGGATCAGCGCAACACGAGCAATGCC
AGTGAATGGGCGCTCCATGTCGAGCACAGAGTGGCCATCAAAGTGCAGCGCGACCGGAGAAGAGAAGTACAGCGTCCAGGTTGCGCCGTTGTCGAACTGC
AGCACGAAGCGGCTGTTGGTAAGAGGAAGGCTGACGGTCTCCGTGGCGTCCAGGCCGTTGATGGTCGAGATGTTGTACGCCGTCTGGAACCGCGGCGTCA
GCTCAGTGTATCGAGCAGTGACGAAGGCCATGCCGCTTGCGAGAGTCACCTCGATCTTCTTCGCATCATCTTCACGGGACATGAAGCGAGCTGCACGCTC
AGATCGTCCCAGTCGAACACCTCGAAGCTCGGGTGCGAGGAGTCGGAGAACTCGGTGGCGGAGAAGGTAAACTCGGGCACTTGGCCGTGCAGGTAGTACA
TCTCGGCATCGCCGTTTCCGGTCAGGCCGCCTCCGAACTCACGCGTCGTGTACGGGTAGTTCATGGTCAGGCCGTAGGGCTCCATGGCGATGCAAGGGGT
CACGCTGTACGGGTTGGTCCACACGGGTTGGATGACGTCGGTTTTCTCGCCGACCGTGGCGCCGATCAGGTTGCCCCACCAGTCATTGGTCGGGATAGGA
CGCGAGCCCACGAGGCCGGGGGCCAGGAACTTGGGCGGCAAGAGCGTCTTGTGCGCGTCGGTGTGGTTGAAGAGGTTCTGGGGCGGGGCTTCGGCGTTGA
AGATGGGCGTGAACAAGTCGAACTTGGCGTCGGGCGCCACTGTAGTCACGCTCCGCAGCGTGGACGCGCCGGGGTGGAAGATGCCGAAGACTGCGGCGGC
GACGAGCAGC