Description :
From Genome Similarity Track
Location :
Scaffold_95:85344- 87101
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18769hypothetical protein

Sequence
1757 bases(100 bases per row)
GTGGCCAGCAATTTCTCGTCGCAACCACCGAGTGTTGCTGATAGTGAAGAGGAGAAAGCGGTGATTCCCATGATGGTAATTCAAAGCAAAGAGGAGAAGG
CGTCTAGAGTTTACGACACAGAAAACCGAACTGACGCTACTAATTTGTCAGTGAGCGATGATCGGAACGCAACGATAGCTCCAAAGCCAAGTGTCGCCGC
AACAAGCCAGATTATTCCTCGACAAGGCACTGAAAGGAGTTCACTACCCACCGTTAACCAAGATCATAACACTGTACAACCGATTGCTGCAGCTCCTGCT
TCTGTCCAAGCTGACAAGATGATCCCTGATAACGCTTCTACCCAAGACCGCGTCCAGCAGAAGACGCTGGCACCAAAGCTTGTTCCTAGTCCGATTGAAG
CTGTTCTATCAAGCAGCAATCCGATAGCGACACTGGATGACGACGCTCCTAAGACTCCAGGCCGATGGGGGAAACGGAAGCGCAAGGTGCATCCGGACGG
CCCCAATGGCCATTTGTGGGAGAACAAGGAGCTCCAGCTCCTGATCAACGCGTGGGAGAAAGCAGCCATTCTCGTGTGTAACAGCAATCCGTCAGAGCGA
CTGTCCCTCAACAGAGAGATGTACCGTGAGTTCGTGGAGATGCAGGGTGGCTACTCCGTACGGAACAGCACAGCCCTTGCAGCACGACGCAGTTCTCTCA
AGTTTTCGTACGCTCATATTCGCGCGTTCAATGAGTCCCAGAAGGCCAAAGGTGAGCCTTCTTTTCACGAAATTCCAGATGATACACGCATGAATTTACT
GCGGTCATGGAAGAACCGCAATTCGGTGGACCTGACGAAGGAAATGTACGACGGATTGGGGCGTATCCTCGCTATGGACGAGAAACTGGCTCAAGTTCGC
AGCATGCGTCCGCCTCCTCATGCTAAACCCAAGAAAACAGCCAAGAGCGCGAAAGAAACGACCGATTCCAAGTCTTCTGATCCGAATCACGCATCTAAAA
CAGCCAAATGGGCCACAGAGGAGACGTCGGACTTGATAAAGGCGTGCGCAGACGTCATGAATGTCCCGACCGACAAGGAATTGTCACAAACTGACCGTGA
ATCGTTGATTTTTGACGCTTTCGTGGTCCGTCGAGAGAATGCTGGAGACACGGACACGCCTATTCGACGCGATCTGCGGTCAATGGCGCAACAATGGAGG
TATATCCTGGCTTCGTACTCGTATATCAAGGCGTGCAACGACAGTCGCTCGGAAGATGAGAGTCCGTCTTGGTTCGAGATGTCCCCCGTGCAGAAGCGAG
CCTACCAGCAGTGTACCAACGTCCCGTTAAAGTTTGTGGATCTGGACGAAGATATGTTCGCTCTGGTCACCAAAACTTCCTTCATGGGTGTACCCACGCC
AACGGAGCCGTCTCCTGCTGTTAAAGCTCCCGCCGAAGGGATCTCGTTGCGTCCGCGATCAACGCGAAAGCGAACGGAGGCGTTCTGGTCGTCCGATTCC
GAGTCGTCCGTGTCTGAAGTCCCGACGCCAGAGGGTCAAAGTGGCAGCACTAAAGACCCCACGTTTACGGCGGGCAAGAAGCGCAACAATTGGCCTGCAG
AGGAGATCTGGAACCTGATCCAAGCGTGGGAAGAAGCGTCGGAAATGACCAAGAGCACCAAGTTGACGGCTGCTATCCACGAAGCCTACGCTCTGTTCAT
GAAGCGAGAGGGTTCAGCTAACAGGAATCGCACGCTGAACAGTGTACGCAACAAAAT