Description :
From Genome Similarity Track
Location :
Scaffold_239:8534- 10275
Transcript NameFunction/comments
g9618.t1hypothetical protein

Sequence
1741 bases(100 bases per row)
TCCCGGACGACATTCCTGTGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCAGGAACGAAGTATTGCGTCACGCGACAGTGGCC
ACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTATG
TTCTGTGTCAAGAAGCCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAG
ATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCT
CACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCAC
TTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAG
AGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCGTACTTGGGTGT
CTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAGTTCCTTG
GACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAAGCTGCATGGGAATGGACTGCTGATTGTCAGC
AGGCCTTTGAAGCAGTCAAGCAGGGCTTGGTTGAGGCGCCGATCATGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGATGCATCCGATTT
CGCGATCGGATGCGCACTGATGCAACACGATCACGAAGGGCGTGATCGTGTGGTTAACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCG
GTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTAGAAGTAGACCATTCGGACCACGCATCGTACATAACC
CAAAGAATGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTC
GACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACCACACCCTCGTCGTCCTTGTTGGATGACGTGAAGGCCGCATA
CGCACATGATGCGGATTCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCTCGTGTACAC
CGTTATCGTATACACACTGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCAATGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCA
CGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAATG
GGTACGCAAGTACGTCCGTGCTTGCGAGGTATGCCAGCGTG