Description :
From Genome Similarity Track
Location :
Scaffold_2:853391- 854979
Transcript NameFunction/comments
Aphas_H257_01166proapoptotic serine protease nma111like protein putative

Sequence
1588 bases(100 bases per row)
GGTTGCAGATGCCATCTTTGTCAACAAAGAAGAGGTCGACCTCGTCCCGATCTATCGCGACCCCGTGCACGATTTTGGCTTCTACCGCTTCGATCCTTCG
CGCGTCAAGTTCCTCACACTGCACGAAATCCCCATCGATCCCAGCGGGGCCAAAGTCGGAGTCGAAATCCGAGTGGTGGGCAATGACGCCGGCGAAAAGC
TCTCGATCCTTCCTGGCATTCTCGCCAAACTGGATCGGGAAGCCCCAAACTACGGCAGCAGCGGGTACAACGACTTCAATACGTTCTACTACGCAGCGGC
ATCGTCCACAAGCGGGGGATCCAGTGGCTCGCCTGTGCTCAACATTGAAGGCGCCGCCATCGCACTCAACGCCGGCGGGGCCAAGCGGTCGGCGTCGTCC
TACTACCTCCCGCTGGACCGCGCCGTTCGAGCTCTGCGGTGCATCCAAAGCGGCCTGACCATTCCCCGAGGCACGTGGCAGACAATCTTCCGTCATGCTG
CGTACGACGAAGTGCGCAAACTGGGGCTCCCGGCGGACGTCGAGACCGAATTCCGCACGCGATTTCCCCTTGAAACGGGATTGCTAACAGTGGATCAAGT
GCTGCCTCAAGGCCCGGGGTTCGGCCAACTGGAAGCGGGGGACGTACTCACGCACATCCAAGGGACGCCCGAAACCACATTTCTCGCGCTGGAGGACACG
CTGGATGCCAACGTTGGGAACGACATCGTCGTCGACATTCGACGGGGCGGAACCCCCGTGACCGTCCAATTGCGTGTGCAAGTACGACTACATTTGCATG
TCTATAGTTTGATGACCCCATGGTAGGATTTGCATGCGATCACCCCGAGCCGGTTCCTTGAAGTCGGCGGGTGCATCATCCACTCGTTGTCGTACCAACA
GGCGCGGAACGGATCGTTGGCGGTGGGCGCCGTCTACCTCGCGCAAGCCGGCCACATGCTCATGAAGGCGCACGTGGCGCAGCCGTGTATCATCGTGTCC
CTGGACAACAAACCCACGCCCAGCTTGGACGCATTTATCAGCACGATCCAAGAGATGCCCAATGGCCACCGCACCGTCATGCGGTACTTCCTCACGCGGG
ACCGCCACCGCGTCCGCAGCGCCGTGCTGACGATCGACCGCCAGTGGTTCCCCATGCAGCTGTACACGCGCAATGATTCGGATGGGCTGTGGCACTGCCA
CGAGTACCCGCTGCCGCCGCTGGCCGACGTCCCCGCCATCCCTGCATTTCCGGCCGCGCCGCTCCGTGTGGCGGGTACAGGGACCGAAGTGGACAAGCAC
ATGCTGACGCGGCTGCTGTCGTCGCTGGTCATGGTGGCATTTGACATCCCACACATGATTGACGGCATCTCGAGCTCCAGCTACAACGGCGTGGGCATCG
TCATCGACGCCGCTGCCGGCCTCGTGCTCGTGGATCAAAACACGGTGCCCATCGCCCTCGGAGATGTCGTCGTGACGGTGGCGGCGTCGATTGAAATCTC
GGCCAAGATCCGGTTCGTGCACCCAATCCACAACTTCGCCATCATCCAGTACAACCCGGCGCTGTTGGGGGACACGCACTTGGAGAGC