Description :
From Genome Similarity Track
Location :
Scaffold_437:8533- 12283
Transcript NameFunction/comments
Phyag_g5698hypothetical protein PHYSODRAFT_543861

Sequence
3750 bases(100 bases per row)
GCGAGATGGACTCGGAGGGCTTCACGTCTCGCGCGTGGCTGGGCCACTGGGTCTCTGGGGACGACGAGCCTGTGAACAATTACTACGAGGACCACAAACT
TATGGAGGGCGCGCTCATCAAGATGGGGGACTACGCGCACTTCCGCTACTTTCTGCTCTTCCGCAACGGCCGCTTCTGCTATTACGAACTGCCCATGCCA
GCTGCGGCTCCTGGAGGGGGGGGAGGACCCGAGGGCCCACGTAGAGTTCACCTCACACTCACGTCCAAACACCTGCGCGGCGTCATGATGCTCAATGCGT
CAGTGAACGCGAAGGATTTGGCCAAGAGCGAGGACGAGTACGACGCCGACCTCATCAAACGCGGCCTCGTGTTCAaccgcaagaagctggagatgcaACT
CACTGGATATTCCCCCACGGGGCAACTCatgagctggaagctgcgggCGGGGAAAGACGCAGTCTACCTCAAGTGGGAACGAGCCTTCCGACTGGCGCTG
CGCCCCATTTGGGTGCAGAACTCCAAGTGCTGCATGGTTTGCAAGAAAGaattcagcttcttcatccgccCGCACCACTGCCGGTATGTTGCAACTTCAC
TGAAAGGGGTTAGAAAGACATGGTATTGATTTTGTGttgtttttgttgctgcagcaaatgtgGCACATGCATGTGTGACGAGTGCTCGGTGTTCGTCCCC
CGACTGCCGATGCAAGGCTATTACGACGAAGTGCGCATCTGTCGGGACTGTTCACCAGTCAAGATCCAGCGATCGGCGCTGAAGCTGGGCACGCGCGTGT
TGGTGTACGGCATTTTGGTGGGCAGAGTGGTGCAGgttgatgctgctgatgaCTCGGAGGACGGGAGGGCGTTCGTGAATGTGGAGCTGGTCAAGAAAGA
TAACCAACTGCGTCGGTTTGCACTGGAACACGTGGAGCTTTACTCAGACGCGGTCCTATCGGCCAACCGCATTAAGAATGCCATCCGCCAACACCTTTCG
TACGCTGTGTTTCGGACAcagctcaacttcaacacgtgGAATTTGATCGAGACCGTCCAAGAGCAACGCACGGTGCAAATGGTGCGAATACTGAACAAAT
CGACGAGTATCAATGAGCTGCATTCGATGGTACCGATGCTCGGCTcgttcgagacgctgcaatTTCCTGACGACGATGTGTCTGAACAAGATCGTGTGAA
GGAATCGCTTTCACATTATCGCGGTGTGCATGTGTCATTTCCGTTGCGGCTGGACACGGTGAAGCGACTGATTAATCAGTTCCGCAATGGAATTTTGTTG
CACCGCGTCTTCGTGCGCCAGATTCTGGACGAGTCTGAGAAGTTGTTTCAAAAGATGCACAAATCGCCAATGAACGAGATTGAGATCCCAATGGGTGTGC
AGTTGGTCGTAGTGGGCGATCTCCACGGGCAGTTGGAAGATCTGCTAACAATTATGGACAAGAACGGCGTGCCTAGCAGCAAAACGTGGTATCTCTTCAA
CGGCGACTTTGTGGATCGTGGTTCGCACGGAATCGAGgtcattctgctgctgctgatatTTAAGTTATTGTACGCTGACTACGTATTCTTAAACCGTGGG
AATCATGAGGAACGTATGATCAACGAGGTTTTCGGGTTCGAGGATGAAGTCTACACGAAGTACGGAACGGACAacgatgaagttgctgggTGGAGTGGGC
TGGGGTCATCGATGAACTACTCGCCGATGAAGCTATTCCAAATGTTCGAGACAGTGTTTGGTCTGTTTCCGCTCTTCGCGTTGCTTAACAAGCGCGTTTT
TATTGTACACGGCGGTCTGAGCAATCACGAAAATGTAacgatcgaggagctgcttcaacttAACCACAGACGTGAAATCCCGACGCAAGGCACGAGTCGA
GCTGATGAGGTATTTACGCATCTATTGTGGAGCGATCCacgtgatgaagacggaTGGAAGCCATCAAGCCGAGGAGCAGGTGTGGAGTTTGGTCCTGACA
TTACGAAGGCCTTCTGTGCAAAAAATGGAATCAGCCTTATTATTCGGTCTCACGAGTGCCGAGAAGAAGGTTTCGACATCGTTCATGACGGTTTGCTTCT
GACGGTGTTTTCAGCGTCGAGCTACTGCGGTTCCCAGACCAATAAGGGCGCCTATGTCCAGCTGGAGTTGGGTGAAGACAACTGCGTTAAGCCGCATGTG
GTGCAATTTTCTTCTCAGCCGCTCCAAAAACTAAAAGACGCAGGCAGAAATGAGTGGAGAAAGAAAGCTCAGCGTTTAGAGCGCAGAACTCTGATGTCTC
TCGTGGAAATTATTTGTGAAAAGAAGAACGCGTTATTGTCTGCGTTCAACGAGATGGATACGGCAGGTTCTGGGCGCGTCACGAAGCTTGAGTGGAAGAC
AACGTTGCAAAAAGTACTGGGCATCGAGGCTAACTTCCTCTCATACTTCCATCAACTTGCTGAGGAGGAACAGGACGGCAGAGTCGACTACCAGAAGTTC
CTCAATCGCTACACTGTCGAACTGGATGGCGGCAATGTGGAGTGGCGGCGTAGCCTGATTCGAAAGGTTTGGATGGGCTTCTGCCAAGCGCTTCCTCACC
CGTCCGAAACGGATTCAGAGAAGATGACGTTGCAGGACAAACTGCACTTTGCCTTCAATTTATTCCAATCACCCTTATCTGGAGCTTCCAAGAAGGAGCT
TGCTGCAAAACCCGAACCGAAGTCTGACGGAACCCCTCCGCTTGGTAAtacttcatcatcgtccagtGGGGGTAAGTTGCAGACGAAGGACAGCTACCTG
CGCAATGGACCAGTCACGTACGAGGTGTTCCGAAACACTATCCAAGGCAAGCTACAACTTGGTGATGCACTTTCAGAGCAGCAAATCTTCGAGTTAATGC
AGCACCTCGACCAGAACCACGACGGTGTGGTTGACTACCAAGAGTTCTGCTCGTTCTTTGCCGAGTTCAGTCGTGCCGACTATCTCCAGGAGCTGTTCGA
AGTGGACGACACCAAGGCCATCTCACTCATGAATCGTTTTGCCACCCTTCTGCAAAAGCCTAACAAGTTTGCATCGCTGCGGGATGCATTCGACGCGTTT
GACCACGGCAAAACGGGGAAATTGACCGTGGACGATGTTTTGCGGGGGACGCAGGAACTGGACATGGTGCCGGAGCTTGACAATGACGAGGCGCAACTAT
TGTTCAACTCGATCCTTCTCAGTTATTATGGCATCAACCAGCGGCATCAATGGGATACACGGGGCTTGGACTGGGTTGTGTTCGAGGACATTTTCTCGCC
CGACAGCACTTTCCAGCGGCGCTTGTGGTTGGCGAGTCTTGGTGCCTCGAACACAAACTTAGCCGGCCTCGACACGCCCGACTCGTTATCcggggacgac
gacagcgttCAGGACGGGCAGACATCGAAGAACCAGGCCTGGGCGGACACGTTCGTCGACAGTGTCAAGCAGTCTCTGCATGAGCAGCGTCTGTACATCA
AGTTCCTGTTCCGGATGCTGGACCGCAAGAGACACGGATACATCACGAAGGAGCAGTTTATCGCTACCATGCAAGCCATCAACGAGGAATACGGcgcacc
actgcagctctcccagctggagcagctggcTGACGCCTTTGCACACCGCAAGACCGTGCGGCACTTGTCGAATGCAGGagaggagatggaggagacgcgC
ATGTACGTGTCCTATCCTGAATTCCTGCGCAGCCTGCGGATCATCGACTC