Description :
From Genome Similarity Track
Location :
Scaffold_573:8533- 10180
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_573-fgenesh-gene-0.0Dynein light chain intermediate polypeptide

Sequence
1647 bases(100 bases per row)
AACGAATCGCTTCAACACGGGCATTCTTGAGGTCGCGCTGAAGGACGAGTACATGGGCGAGGCGTTTGGCGACGACCGCATGATGAAGGGATACAGCAAA
CGAGTCGAAGAACTGCCCAACCATCCGGATCTGAGAGACGCGACACCGTGGAATGTGTCCACCGAGACCAAACCGCCCATGCGAACTGAGCAGGTTTGGA
AAGCGTTGTCAGAATGAGTCCTCTACTGTGTGGTCTCACGACTCGGTTCCTCTCGTATAGTTTGCGAAGTTTGAAGCGGACCGCTTGGCCACCAGTGCAA
AGTGGAAGCAAAAGCTCGGCACCGAGCTGACGTCATATAAAGACCCCGTGACTTTGGCCAAGGAGGAAAACGAACGGCTGCGACAAGAGAAAGTCGCGCG
CGCCGAGGTGCTAGCTGAGGNNNNNNNNNNGTTGGCCAAGGAGGAACACGAACGACTGCGACAAGAGAAAGTCGCACGCGCCGAGGTGCTAGCTGAGGAA
GCGCGGCGTACGTCGTGGTACAAGAAATGAGCGCAGCATCCATGATATTGGAGGATGGCCTTTAGAGGGGGCTGAGATTCCCATGCAGACGTTCTCTCTC
AATATTCCATGCATTTTGACCCTCCTTCCATTCGTGGGGCTTGAAAGGTCGCGGCGGTTGGTCTCAAGTGGCGACCTGAACAGGTACCACATGGATTCAC
GTCCACAGGAGATTCAACTTCCTCCGAGCGAAGAGTTTCCAGCATGCCGACACCCAACGCCCCCGAGTCTCTTGTGCTCTATGGTGACCCGATCTTCACA
GGTGAGACCGTGGACCCGTCCAAGAAGCCTCCGCCGTCTACAGGCGGCTCCACCGACAAGGAGTCACTCGCGCGTATCGAAGACATCCTCAATGCCGTGC
TGCCCCCACAGTAAGTGAACGTAAACCACCCATTCACCGGGAATGCTGTTTGACTGTATATGTACTATCACCAGGATGTGGCGAGAAGAAGACTCGGGGT
ACTGGATGCGGTACACTTCACCGACGCCATCGACGCGCTTCGACGTGATCAAACTCCAAGAAGAAATGGACGCCAAGCTCATGAAGCGGCAGGCTCGCGA
GAACGGCATTTGCGCCGTGCGTGAGGACATCTACCACCAGTGCTTTGACGAGCTCATCCGCGAAGTCGCAATTAACTGCCCCGAGCGCGGGCTCTTGCTG
CTGCGCGTGCGCGACGNNNNNNNNNNATTCGGCTCACGACCGACGCCTACAAGACGCTATACGAGAGCAGCATCACGTTTGGCATCCGCAAGCAGCTGCA
GGCAGAGGACGGCATGGGCGATCTTCATGACCGCATCGCGCAGCTGCAGCTCGACAAGCAGCAGCACGAAGGCAAAGTGCTTGAGCTTACGAACAAACTC
GAGCTCATTGAAAAGCGCGCGACCGAGCGCAAGGCCGTGCAGGACAAGAAATATAAGGAAGAACTCGACTTCCTCAAGTACCAGGGCCAGCATCTCGATG
CATTTCTAAAGTCGGCCGGGGGTGGCAGTCTCGCGGCCGGCAAATGAGTAGTGGAGCTCTTCGTGTCGTAACAGGCAGGTCTATTGAAGCCATCCACTTG
CACATAAAAAAGACGACGTATCGGTTATCTCACAAATGATTCAGGAA