Description :
From Genome Similarity Track
Location :
Scaffold_90:85321- 88235
Sequence
2914 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCTTCACTTTTACTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCGGTCTTCCCCGAGGCAACGTGGTGAGGATAGTGAGGATCTCTTC
TAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGTCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTT
CCGACGACGCCTCTTCCCCTGGCTCAATCTCCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCAT
TGTGGCGTAGCGGGATCAGCAAAACCTGCGAGATTGCCGATTCCAACTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGT
GTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGTTTGGCGAGACGTG
GGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATC
GTAGATCTGGTCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTCGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGAATCTTGAGAGTTG
AGAACCTCTAGGGTGTTCCCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGTGTAAAGGAAATCTCACTAGGTGGTAGGATCTGGCCAATG
TATTATCCAGTTATCGCTACCAACACTAGATTCGCAATTCCCAACCTTCTCCTAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCGGGAAGGCAC
TTGCGTGATACTGTGCAAATTGAGGACTGTATTGATATTTAAGCCTATACCTGCCTGTATTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCA
GGCTCGGGCTGCATGTCCCTTTCTTTCCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGGCGTAATCATTACGGTCACCCTA
TTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACTTCACTGTAAGTGTACACTCGTCGTGGATCTGAGCTCTCCACTCATCCAACCTCATCTC
GCCATCGTCTGTGATCCCCATTGTCCCACGAAAGTTCGAGATCCACTGCATCCATCATCCCTATACCCTGGATCCAGGTCCCTCTAGACGGGATCCTCCC
TCCATGGATCCGAACTCGGAAGTATGGGATCTGGGGTACCTCGCGGTGGATCTTGACTCCCCATTAGCCGTGGCTACTAGATCCACCTTCAGAGGGCACC
GACCATCTCTTCTTTCATAGGATCCACACCCGATCCACTCTTGTATAGTATATCCCAAAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTT
CGTACATCGCTTATACCAGATCCATCGTCATTTCCTACGGGGTGCTGCTCATCATGGCTAATCCACCACCGGCAACTTGCATCCGTGCCACCAACCCAAA
TCCTCGCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAGAAAGCACTTCACCACATACGGAACG
CGTAACCGTACTGCAGCTTCCCGCAAACGACGCAGCGCGCCAGGGTATCCGTCGTAGACCGCGTCGGGTAAGCAGAAGAGGGTCAATCTTCGCCTCGCAT
TGCTTGCACGTAGGGCCCACCAATTTGTAACCGTGGGAGTGTTAGCTAACAGATTGTATTACGCAAAACGTGCGTCTGAATACCGCCAGAATCAATGTTG
TGTGAGGCCGAGACGGTTTGATTAGCTGAAGAGGGACACTCTTGCCCAACCATTAGAAGTTTACGCTCACCTTAAAGCAGTAGTTTCAGATAGTCGTAGG
AGTGAGGAGACACTGGCACGCCATCTATCTTTTTTTAGATGATGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTAAAATGTTTCTAAATATAGTATTGCTAGCTTTAATATATTATATCA
GATCTCCAAACAAATACATACTTTACATGCAATATAAATCGACTTAAACAATTATCGATCGTGCGCGCATATATTCGTCGGGTACGGTGCACGGGAGCAG
ATACCGCAATGACA