Description :
From Genome Similarity Track
Location :
contig_105:85319- 88336
Transcript NameFunction/comments
g13069.t1hypothetical protein

Sequence
3017 bases(100 bases per row)
TGCATCTCGCGGACGACGGTGTGGTTCAGGCGGTGGGACCGGCGACATTGTCATGTCGATGAAGACGCCGCGCGGCATGAAGAAGGGTGTGCTCACGAAT
GTGTGGCATATCCCGAAGCTGTCGCGCAACCTGTTTTCGGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACGGGTGCTTCGCGG
ACAACAAGGGTCTCAAGTGGCAGCTCGGCGCTCGTGAGGGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGCCAATGCGGCAAG
TTCGAAGGATCGCCAAGGGGACACCACGTCGTACCTCTGGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAGAAGAGCTAC
GGTGTTGGCATCGACATGACGTCGGTGAAGCAGTGGGAGCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCCGA
ACCGTGCGAAGCACGTGCTGGAGGTGGTTCACAGCGATGTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATCGA
CGACAAGTCGCACTTCTGCGTCGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAACTCAGACCGGC
AAGCGCGTGCAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCAGAAGTTCACTC
CGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGAC
GTATTGGGGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCGTCAGCCACGACAAGTCTCCGCACCAAGTTTGGACGGCAAG
AAGCCGCTGCTGCGAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCG
GTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTC
TTCGACAGTGGGAGACGTGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACA
ACGAAGAAGAGGAAGAAGAGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCACTGGAGGAAGTCACGGAGGT
TCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTC
GTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGC
TGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGA
GATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCC
ATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCT
ACATGGCACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTG
GAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTC
GTGGCGCTGTACGTCGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACC
TCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGACCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCA
AGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACAC
GATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGCCAG
TTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAG
ACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATG
CATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCA
AGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTT
CCACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACGACATGC
TGGCGGACATGATGACG