Description :
From Genome Similarity Track
Location :
contig_105:85318- 88335
Transcript NameFunction/comments
g13583.t1hypothetical protein

Sequence
3017 bases(100 bases per row)
CCGGCGACATTGTCATGTCGATGAAGACGCCGCGCGGCATGAAGAAGGGTGTGCTCACGAATGTGTGGCATATCCCGAAGCTGTCGCGCAACCTGTTTTC
GGTCGGCCGCTTCACCAAGGACGTCGGGCCAGTGACCTTCGAGAGCGACGGGTGCTTCGCGGACAACAAGGGTCTCAAGTGGCAGCTCGGCGCTCGTGAG
GGCAAAGGGCTGTTCAAGCTGTGCATGACTCCGATGATGCCTGACGAGGCCAATGCGGCAAGTTCGAAGGATCGCCAAGGGGACACCACGTCGTACCTCT
GGCACCTCCGACTTGGTCACATTGGCCATGGCGGTCTAGACGCCATCGTCAAGAAGAGCTACGGTGTTGGCATCGACATGACGTCGGTGAAGCAGTGGGA
GCTGTGCGACGGGTGTGCACTCGGCAAGCAAACGCGAGTGAGCTACATGAAGTCGTCCCCGAACCGTGCGAAGCACGTGCTGGAGGTGGTTCACAGCGAT
GTGTGCGGCCCCATGCAGACGCCAACGTTTGGGGGCAAGCGCTACTTCGTCACGTTCATCGACGACAAGTCGCACTTCTGCGTCGTGTACTTGCTGAGGA
ACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGAAACTCAGACCGGCAAGCGCGTGCAGACACTCCGGAGCGACAACGGTGGCGA
GTACACTTCCGGCGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCAGAAGTTCACTCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGG
ATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGATTGCCCAAGACGTATTGGGGAAGCGGTGATGACGGCTACGTTCCTCCGT
AATCGGTGTCCGACACGCGCCGTCAGCCACGACAAGTCTCCGCACCAAGTTTGGACGGCAAGAAGCCGCTGCTGCGAACCTGAAAGTGTTCGGTTGCCAC
GCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGAT
TCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGACGTGACTACCATCAGAGGGAGGT
GGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGAAGAGGAAGCTGCGCGGGACGAA
GACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCACTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACC
AGACGCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTC
GGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCG
AAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGT
TTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCT
CAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACGAAGACCAC
CCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGT
TCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTGTACGTCGACGACTTGGTCCTCGCTAGCAG
CAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAG
AACGACCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCG
CAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTC
TCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCT
CAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGG
GCCGGCGACATCGAGTCTCGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGC
TGTCTTCAACGGAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCGAGCTCGGCGAGATGGCAAGCGAT
GAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGCAGTTCCACAAGCGCACCAAGCACATCGACATTCGCTACCACT
TCGTGCGCGAGAAGGTGGAAGACGGTCAAGTGGTGCTGCAGTATGTTTCGACAACGACATGCTGGCGGACATGATGACGAAGGCATCCTGCAACGCAGTT
CAGTGTGCTCCGGACCA