Description :
From Genome Similarity Track
Location :
scaffold_6:85280- 89764
Transcript NameFunction/comments
g400.t1hypothetical protein
g401.t1 hypothetical protein PHYSODRAFT_286375
g402.t1 conserved oligomeric Golgi complex subunit 8, putative

Sequence
4484 bases(100 bases per row)
TTCTCGACTCGAATGAGCTCACCAGCAATCAGACGTACGATTTTTGCGGAACCCTCTTTAGAGATGATGTTGATGAGAGACTGCTGGCTACGCTGAGAGT
GATCTTGATGAACGAACAAGAAATTCGCTTGTACAAGAAGGTAAAGTTTTTTACCAGTGGAAAAAGCTCCAACTAACAATTTTTTATGGTGCAATAGGCT
TTTGAAAAGGAAATACTTAGCGTTCGCAATGAACTCGCAGTGTATGAAAACCTGCAGAACACTTGTCGTCGCAAGCTCGCTAATTATCCGACTACGTGCG
TGTACCAGACTCAAGAGTCATTCGGTGCTGAACTAACCTTTGAATGTGTTGTAATCTTACCGGCTCCAGACTTGAAGAGGACGAAGCGATCTTGGCTGAA
ACTAAAACGGAATCGAACCCTCGCCTGGCGTTCGCAGTTCGTGTCCGCATCGAAGACAAGCAAGTGTTTACAGGCGTCATTAACACCCTCGAGCAATGGA
AGCAGGCACTTGCTTCCAACCCCGAAAAATACCCACCGAACGCCACACGTTTGTAAATCGATCTTGTACAAGAAAGGTTTTGCTAAATGACAATCTTTTA
GTGCATTTTATTCGTCGTGTCTAGCAGTGCGGAACTTCACACCTTCGCTGCTTTTCTTAAATTTAGTTGGTCAGCTTGCGGTTCAGCAACTGGCGCAGCA
CACTAGAAGTGAAGTACGGTAAACGAGCATTCACCTCTTCATCATTGAGGAACTTGGCGCCACCGATGTGTCCGTGGCAGTTTGGTGCTCCGCAACGGCA
GTCAAACTTCTCGTCCATGTCCCACTCGCTCGTGGCGTAGTCGAAAGACAGATGGTCGCCCTCCTTGATCGGCTTAATAGCAATAAAAGACACCTTGGCC
TCGTTTTCCACCATGTCAATGCGTGTGTTGGGATTGCAACTGTGGTTCACGAATTCGAGTCCACCCGTGAAGTCCATGTGCTTGTCGGGCGTGATCTGCA
CCGTGAACCGAGTAGGCTTTGAGTACTGTATCAATGAAACCGCAACAACAAGTGAGTCTTCAGGAGGGAGGAACTAGATCTGAAGAAGCAGCTTACAATT
GTGCCAGGTGCCGAGCCAATGACGTCGTCCTTCTTGAAGTTCTGGCCGGCAACTGCCGAGCGCCATTGCTCGTTCCTGTCATTAGAAAGTAAGAATTCAC
GTTAGAACGGTTGATAAAATTGCGTTCTAAATGCGTGTACGTACAGCTGTTCGATGTAGAATCGTCCGTCGGAGCCCTCAGGGATGTAGCTGAGCTGGCC
GCTCTGCTGCGCATCATGACTGTGGCCGTTGACCTTCACGTGCTTGGCGCCGTTCGAAGCAGACACAGCAGCGAAGTGGCGGCGGCTAATAGCGCCGAAG
GAACGCGAGAGCAGAGGGACGTTACGGGTGAGCATGGTGGTAGGGGCTTGTGCTTCGTGCGATGCGAAATCGACTGTGTGGAGATTGCGAAGATCGGATA
ATGCCCTCCTTCGGTGCGTGGGATCAGCCGCTACAGTGACGACGACGCGGCCACATGCTTCTTCCTGCCCGAGGAAGGACCTGTTGCGTTTCGGCTTTCA
AGTCGCAGATGGATCGGTCGTCAGATCAGTTCGCTGAACTTGTTTGTATGGATTTCACTATGTCCGGATTAGTCGTATGAAACATAGTGAAAATTATACT
GTATCGTCGCAAATGACACGTAAACGAGGGGCTAGGGGTTGAAGTTTGAAACGGCCAATTTTGCGCTTCAACCTGCTTCAGTTTTCCCTCAGCTGCGGTT
TACAAAAAGATTCTTGTTGGCACCAATTTGCTGCTTTGGCCTCATGGCTGCTTCGATACGGAGTCAGAGATGACTAAGGCGGACGCCTTGTCGCTTATCA
GTGCATTGTTTCTATTGCGTGCTGGCTTACAGCAAGGTGACATGTACATGTCCTTCACGTCGGGTTCAGCCACACTGCGGCCTGCAGTTAACGTGCACGT
TGACGATCCGTTTTCGAGAGCATCCTGCCTAGCCATCATCATTGTGCCCGCACTGCGGGCCCCGCAGGCAACGCTAAAACGTATATCTATCCCCCCAAAT
GCAAGTGAAGAATCTCAATCCTAGTCATGACTTCCGACTTGGGATGTTTTTTCAGTTATTGCTACCAATAGTACACAGGATGAATGTATAGGAGCTGCCA
ACAATTGCTGCGCGATTCCTTCACAACTAGTTACCCCATGCGCGCTTCGGTGTCGAAAAAATGCGAAGGTCTCTCTAAACTGATGTCATAAAGTTTAAGG
TACCGCTTATGTTCCGACCACAATTACGGTATCCCAAATTGAATTTCTGAAATGGCATCCCTCAAGACGTGCTCGCTCGAGGAGCTCAAGAAGGAGCCGT
GGCGGCTACAGATTCAGGCGGACAACACGGCCGAGCAGCTGCGCAACCTCGTACTCAAGAACTACCACGTTTTCATTCAGAGCAACCAGTGCGCCGCCAT
CGTGAAGGATGATGTAGGTGCACGATCCGTAGCAAAATTATTGCTTCTATTTCCACAATTAATTTCTTACAATTTTTGTTTTGTTATGTTTCAGCTAGGA
GAACTTAAGGAAGAGACCACCAAGATCGAAGATGCCATTCCAGCATTGCAGGAATACTGTGCTAAGTTCCAGGAGGAGGTGACGGATGTTGTAGCCAAGC
ATGGAGACATCCAGTTTGTTTTCGAGCATTATTTGCAGGCAAAACGCAATAACGTTTTATTGTTTTTTTTTGCTACTACTAACGCTACAATTATTGTGTT
GTGCAGCTAACGGAGTTGCTGGAGATCCCGCAATTGCTGGAGGCGTGTATCCACAACGAGCTGTTCGACTCAGCACTGGATGTGATCCAGTTCGCCAATG
AAACGTTCCAGGCTGGCGATAACATCAAATCCTCGCGCAACGTGGTAATTGATTGTTTGGTGCGCGAAGTGGCGGAGATGACGAGCATCATGCGCGAAAA
GTTGCTGCAGAAGCTACGTGAGGACTTGCAGTTGGCTCTGTGTGTTCGGATCGTGGGGTATCTCCGACGTCTTGATGCGCTCGTTGAGAAGGATGGAGCT
GCAGCTGTGGGGTCACTGGAATACGAAAATCAGCTCAAAGAGGAGTTTCTTTCCTGCAGAAATGTGTGGCTATCGTCTTTGAGCAGAGGGATTTCGTCCT
CCGACCCGTATCAATTTGTGCGCTACTATCATTTCCGGATCTACGCGGTTAGTGCGATATTCTAATGATCCTCTACTGCAGATCATTCAAGTCATCGACA
TCAAGCGAACGAGTTGGTTCGACATGATCACCCAATACTCGGCGATCTTCGGTAGCGAGGTGAGCTCATTGGTGCACGAAAGCTATTACCCAAAGATGCT
AACAAAATGCCGTATTATGTTACAGAATGTCGATGGCAAAGTGGATCCACCGCTCTGTCGCTGGGCGACCACAACCGTAGCCAACTTTATCCACATCCTC
ATGAAGTACGCAGGCTGGCAGAATACAAATGGTTCCTGACTTCAGAATTTATCTCACTTTTGTTTCGCTGTGGTCAGACAACTACCGAAGATCGATGACT
TCAGCTCCATTGCGACGATTATCGAGCAGAGTTTGTTCTTCGGAGGGTCGCTGGGTCGTGTTGGTGTCGATTTTCGAGCTGTGCTAGTCGTGTATTTCGA
GGACCACGTGCTGAATCTGATGACAGAGCACTGGCGTTCAGCTTGCCGTGAGTTCCAAGCGAATCTGAGCACGCACTCGTTGTCAACCTCCAGTGGTTCG
TCATTTTCGGCCTCATCCAAGACACCCATCGTGATTGCATCGTATCGTTCATCAGCTAACGGAGCCGGCAACAGCTTCCCGTTCGCTTCTCGTGCTACAG
CGGCCTCCTCCAGTGGAGAGGATTACTCTCCTCCGCGATGCCTAATGTCGTTTCCTTTGCTGGCGGAGTTTACCAACGCTCTGCTAGCTTCACTGAACGA
ATTGCGACTGTGCGCGATATCTTCCCTGCAGAACCGTTTGGATAAAAAGTACCAGAGTGCAATTGGCACGATGCTGCTCACGATCGCGGACTTTGTCGAG
GAGAACGGACTCGACTTGCAGGTCAAAAGCGGCGATAGCCATGGTGAAGGCACTAGCACGACCCCAAGGAACGCAAGGGCTGCAGCTCTTGCCGACTCTG
TTCGTGCGATGATCGAGGTACGAAATAGGTGGTTCCTTTGAATTTGTGCGCGTCTAACTGTTGATATTTGTTACTGACACAGGTGATTCGGGCTGAGCTT
GTGCCATACCTGATCAAATGCTTCCATCGTCTGTTCCCCGTGCCATCAGCTGCACTCAGTGCTATCAACGCCGTGACAAAGGAGATTGAAGAGTTCGATG
AGATCATGCGGGAAGCTGGTTTGTTGGTTCCCGACGAAATCGAAACAAAGGAAGAAACGGATGGTACAAGTACTTCTCAAGCCA