Description :
From Genome Similarity Track
Location :
Scaffold_415:852464- 865743
Transcript NameFunction/comments
Aphin_H310_06375ubiquitin protein ligase

Sequence
13279 bases(100 bases per row)
CAGCACCTTGAATATGTCGTGGATTCTGTTGATACGATCAAAGGACTCTTCCATCACATCTCTAGACTGGCCAGCGATGTGTATGGAAGTTCGAAAAAGA
CGGAGGCTGTGGCTGAGTCTGCACAAGACCCGTCGGCGTCCTCCGAATTTGATACGCGTGTGTCTACGTATCTTCAAAACGTCCAAGCATTGAATGCAAC
GACGATGAAGGAAAAACACAACTACGAACAACGCCTTCTTGCAGTTCGGAATGCGTCCAAGAGTCAGCGCAAGGTGAGTCCGCCGCCGTTGCCACTGCCA
ACTCAAAACTGCATGATTCTGGGTTGGGACATGGCGATTCAATTGATGAAAGCCACTCGAAAAGAAGGTACTGGAGAGACGTACCTTCGCGCCGTCCAGA
CCATTCAAGAGCACTTGTCGACACTCAAACCGCTGGCGTATTTGGACGGCATGTACGTAAGTCCGAGCGCGAGTCAGTCCTTCAACCTTCTCTGCGACTT
TCTCATTCAAGCCGCCACGGTCATTCCAGGGCGTGACCCCGCCATTGAAGAGGAAATTGCGAGGCAGTCGATCTCGGTCCTTTGCGACTTGGCTCTGGCG
CGCGGGTCGCTGTCGTATTTGTTATCGTCTGTGCTTTGGATGTTGTCTTGTCCAGAAAATACGCCATTGCACTTGCATCCGTTGCTGACCAAGGTGGCTG
CGATCAAGGAGCAATCCTTGTACGGCATTTGCGAAGCATCGGGTGAGTTGTACTGCTGTGGCCAAAACTCGTACGGCGAATTGGGCGTTGGCGACGACAT
TGAGCGCCACCAACTCACCTTTGTCCCTTTTGGTGGCTGGGACGACATCAAGCAAGTTGTAAGCGGCAACGAAATCCTCGCCATGCTCACGAACAGCGGT
GTCGTTCTCACTGCGGGTTTAAACAAGAGCGGGCAATGCGGTCATGGCCATTTTGACGAGCGCGTGATGCTACTTCGGCCCGTCGAAGCGTTGCGGTCCC
AGAAAATTCGGTTCATTGCCGCCAGCAACGGCTGTGAACACATGATAGCCCTCACCGAAGCGGGTCTTGCGTACTCGTGGGGCTACAACGACCGTGGGCA
ACTCGGTCACGAAAATTTGACCACCAAAATTCATCAACCCAAGCTGATCGAGAGCATTCGTGACAAGAAGATCTCGTTTGCCGCCGTGAGCTACCACCAC
AGCGCTATCCTGACGGACAAGGGCGAGTTGTACACGTTTGGGATGAACGATTGCGGCCAACTAGGGCAAGATACGACGATTCACGTGTCCGAGCCGCAAC
ATGTCAAGGCCCTTGAAGGTTATGCTGTCTCGATGGTGAGCTGCGGCTTGTACCACACGGTGGCGTGTACATCCACGGGGGAGCTCTTTTCGTTTGGAAA
GAACGACTACGGACAGCTGGGTGTGGGCCACAATCGCCAGAGCAAGACGCCGTGCTTGGTTGCAACGCCGAACGAAAACATTTGCTTTGTCACGTGCGGG
TATTACCATTCCGTGGTCGTGGCTGCAAGTGGGCGATCGTACTCGTTCGGGCGAAACGACTACGGACAACTCGGAATTGGCACCAAGGTCCACCAAAGTG
TGCCGCACTTGATCACGCTCGGACCGCGCATCACGCGAGCAGCGTGCGGGTGTTATCACACTGTTCTCTTGTCCGAGCAAGGTCTGGTGTACACATTTGG
ACGCAACAACAAGGGTCAGCTGGGAAACCGCGGCAACACGGACTCGCTGCTGCCCGTTCCGCTGCATGTCCGACCGGAGAAAAGCGCACGACGGGTGCTC
GACATTGCAGCCGGGTTTTACACCACCTCGTTGATTGTCGAGCGCAAGAAGGATGGGGATGTAGCGACGGCCGACCAGAACGTTGTGTTGCCATTGTGCG
GCCGCGTCGACATTGATCGAAGTGGCGAGATCGAAGGCCTGAGCAACTTTGGCTCGATCAGCGCCGTTGGAGTGAGTTTGTACCGTGGCAAGTGGTTCTA
CGAAGTCGAAGTAGTGACGTCTGGATTGATTCAGATCGGGTGGATTGACGGGTACTTTCAAGGATCGTCCGACCAGGGCGAAGGCGTTGGTGATCACGCG
CACTCATGGTCGTACGATGGCAATCGCCAGCGCCGGTGGAATTCTGGCTCGTCCGCGTACGGCGACAAGTGGAAGGCTGGCGACATCATCGGATGTCTCC
TGAATCTCGATGACTTGGAAATGCGTTTCTTTCGAAATGGAGTGGACCTTGGTGTCGCGTACTCCAACTTGACTTTGATTGCGTCGGATGCACGTGCCGG
TCTCATGCCCGGTATCAGCCTCGAGCGGGGCGAGATCATTCGACTCAATCTTGGCCATCGCGCGTTCGCGTTTCCAGTGAATGGCATCGATGGTGTCGCA
CGCGCCATGGTGTCTCCATCGTCGCAAGTGGTGCTCCAAACCGCCACCGTCGCAAGGACCGCCACAGCACCCGAGGCATTCGAAGGATCGGCGCGAATTC
TCGTGGGGGATAAATTGTTTGTCATCGGCGGGATGCTCTCTGGTCCGACTGGAGTTGGCAGCGGTGTATCGACAAACAAAGTTTGGGTGTATTCGCAATC
GGACAAGACGTGGGGTCGATGGAGCGACCTCCCCATCGGCATTCGATACCACCAAGTGGTCGCTGTCGATGACCATACCTTGCTTGTCATCGGGGGTGAA
CACGATGGGCCGGTCTCGCGGCACTTGGACCTCTATCGTGTGTCTACCATTGCCAACGCCGATGGCTCGTTCCCACCGTGGGAGTTGGTCCAGAGCACTG
CTGCGACATCATCCGTGCCACCACCTCGCGCTCACCACACGGCAGCGGCCATTCGCATTCGACTGGAAACGCTTGTCCTGCTCTACGGCGGCAAATCCAA
CGACGACACTCTCTTGGGTGACACGTGGTTCCTGTCGTTAGAGGACTACTCGTGGGCAAAGCTGCCGTCGTCGGTGGCCCTGGACCCTGGCCCACGTTTC
GCATGTACGTCGTGTGTCGTGGGTGAAAGCGTGTATGTATTTGGCGGGCTCGACAAAGAAGACCGGTATCGTGCTGACCTGTGGCGATACAACACGTTTG
ATCGGGTGTGGCACTTGTGTCACGACGATTACATTTACACTCCCCGCACGTCGTCATCGTCCGAGAGTGTCAAGGATTTCAACCCACCGTTGCCGACGCC
ACGGATGCACTACAGCATGGCATCGGACCTTGGCCATATTTGGATTTACGGGGGAGAAAATCGCAAAGGCGACTTGCTTGGCGACCTGTGGGGATTTTCG
CTGACCAAGTTGTCATGGTGTCCAGTCGAAGTTGAAACGGACGACAACGTCAGTGGGATCGGGCGCGCGGCCCTTTTCATCGAAGCAGGGAGCGTTTGTG
CCTTTGATCCGTTGAAGCCATCGACATGCTTATTGTACGGCGGACGTGTAAGCCGCACAGCGGGCAGTGGAGCCACGGCGAATGTGACAACCAAGTGGGA
AACCATGGTTCGATACCTATCTCCGACATCCAGCTCGAAATTGCCGTCGTCGTGCACTCCGTCCTCGACGTCGTCGTTGTCGTCGCTTGCACAGCTTAGC
AAAGCGTCTACTGTGTTGGCCAAGTTGCGTTCGAAGGAAGTGTCTTTGCTTTGTCCTCCCACGGCAGGTGACACCGCGCTGTGTTTGTTGTCGCACTTGG
ACCGCTTGATTGGTGACGACGTCCCGCTGGCGGATACGGACTCTATCCAACCGTCGCGTTGCAGCTACCGGTCCCTGTGCATCGATGCTCGTGAATCGTC
CTTTGCGGTCTTGCTTCAGCTGCTCCATCGGCTCTCGTCAACGTATTTGAATCCAATGTCGAAGGCGACCAAGGACCTGTACTCGCTCGTGGTCGTGCTT
CGTCTCGTCAAGTTCAACTTCTTCGAGGTATGGCTCGTGCTGCCGTTCTAAACCTGTCAGGATTTCTTGTAGTTGTCAACCTCGTGCTTGGATGTCAACG
ACATGGGATTTGTGCCAACATCGACGGAGCCCGGTGGAACGCTCTATGACCTGCGAGAAGTTCTCTTTCAACTCGCCGACGCGCCGGCGCCATCTCGAAC
CACGTCGCCAGACGTCGTGTGGTTCAGCCAAGCCATCCAGCGGGAAACTGTCGCGACGATCAACGCGGGGTTTTCAATCATGTTTCCATCCCTTCTCGAC
CGTCTGGCCATTCTCACGAGACTCTTGCACGACGACAAAAAGACCACGGACGTCTCCAACCTCCTCGTGCCGATGCTTGTTCCCAATTTTGCGTCGCCAA
AAGCGCTCTTTGCACTCATGTCGGAGGCGACACTAGTGGCTGAAGGAGATCGCTGCCACGGCGTTGTGATTGCATTTGCAGACAAGCTGCTGCAATCGTT
GTGGATCAAGACGTCAGCGACAGGTCCACACTCGTCTTGTTCCACCGATGTGACGTCGTCGATGGAATTCCAGTGCCTGAACGTGCTCCTTCGAGCAACT
GTGTTTTGGGCGTCGTCATCGTCGAGCGGGCAAGGGTGGGCCATCGCGAAACACATTTGTACCAGACTTGTGCATTTCATTCAGTTGCTGCTGGACAGTG
CTACATCCGCTCAGGTTTCCCCAACTGCGGTGGCGGCTCTACTGGCGACGAGCTTTCCCGGAAAGCTCTTGCCGTTTCTCCTACTCAACATGACCAGTCT
ACCGTCGATTCAGGCCACGTTTTCGTCGGCCGTGGCGGATCTTTGGCCCAACTTGGAGCTCCTACTGCACAACATTCATGCCTTCATGACTTCAAGAACG
AGCAATGAATGTAATTCAACCAGTCTCAAAGGTCCCAACGCTGCATCCGCATCCTCCTCAACGTCTCGATCGTGTTTGGACAACGACGCGCCGTTGCATC
ATTTCGTGGTGCTAAGCGCCGGCATCAGGAGTCTATTGCATCGCTCAACAGCGTCTCCACCGCCTGCTAAAATGACGGGACTCGAATTTTCCACTCGGTT
CTGGGAGCACATTCGCACGACGAGCTCAACATTCTACCGCATCAACGTCACCGCCCGAGATTTTGACTTGTATCGTGTCGTGCTGGCCCCTGACACTGCC
ACCGTTTTGCAGCAACGGTCGCTAGTGGTTGGATTCCGCGGGCCCCCGGACGACTTGGCAAGAACGCCGTACGATAGCACAAAGATTAGTTTGCACTTTT
CGTGGGATGTCTTGACGACCCAAGTTCAAGTGAGCCATGCCGATACCAGTGCAGTTCCCACGACGTCGGGGGAATCAAAAGCCGCTCCAGCAACCAATGT
TGTCGACGTTGACGAGGACGGCGCCGGTCATGTGGAATGGCTGCACGATTTTCAAAACTTGCTGTCGCATCTGGGAAGCCACTACGCGTCATCGTTGATT
CGCGGAGACGCTGCGGACACTGCGGCGACTTTGACTGCAGGATTGGAACGATGGATCCAGTCGCCGCTCTTTCGAGGCGGTCTGGAGGAACACCCGGCAG
CGGGAGACACTCCAACAATCCGCAATGCGCACATTTTACAACAGATTCTGGACAACGAAGGCGCTGGCGCGAAACTCGTCGAAAAAGTTAAAGCCGCTTT
AGATCCGGACGCTGCATTGGCCCACATCAACCCGAAACTGCGCGCTGCGTCGTCTCGAATGAAACGAGTGGATAGCGTCGAACGCACCCTCGAGAAAAGT
GGCGGTTTTGAGGCTGTGGATCGCGCTGTGCGGTCGACGTTTGCAGTGTTGCTCAAGCATACCCATGTTGCATACACGAGCGACCCGGTTACGCGCGATG
GGATGCCTGGAGAGGCGCTTTTGGATGCGTGGAGAGCTGCGCTGCAGCTTCGACGATGGTACATCGATGCATTGGTTACTTGGACCAAGACCCTCAAAAC
ACGTTGCGTAGGATTGTGCGGGAGCAACAGAAATTGGCCGTGAGTTCGTGGTAAAGACTGGACGTTCAAAATCGCCCACGCAGAATATTGATTATAGCAT
TTCATCATTCTAGTGACGGCAAAGTGAACGACGACGAAGATAATGACTTGGCCAAGGAGCGACAACAATCTCTGTACAAGCAAGTGTGCGATCCCATCGT
TGCGCGCGCACGGCTTTTGCTGCAGCTAGCGGCAGTACCAGTTTTCACGCCAGTAGACGTGAGCCATTCGCCTTTCAAGATCCTCCCCGGCATCTCCAAC
ACCCCATTTGGTATGGCGCTCCTTGAGGCTAGAAATCTGCATGCTGAAATCATGCCATGCAACGCATAGATTTCTCCAAGGGCTCCACGTCGTCTCCACC
CATGGCACGTGTGGCGCCAGAGGATGGTACAACCGACCGTCAAGCGTGGTTGCGTCAGCTCAACCAGATGATGGAAACCAAATCCATGGATGCAATAGAA
GAGGAAGACGAGAAGATTCAGACGGATATCTTTGCGTTTCTACAGCAAACCCCCGATACGAGTGTTGAAGCGGCCATGAAAGCGCTCCTCGGCGACCACC
AACTACGCGCCAGCAGACGCCTGCAAGGCCTGAAAATATTCTACACACTTCTCAGCAGCACAGCGTCGATCCCGACCGCTCGTTTCCACATTTTGCCCAT
TCTTGCAAAATCGTTTCGAGCAAGTTGGGTTCCCGGGTCCGACAAAGTTCACTATTCCCATCAACTGGAACTGGCTGGGCGGTCGAAGATCCAGGCCATT
GGACGGCAATTCTTTGCACTAGTGTCATACCTGATCGACCATTCGTCAACGCATCTCCTCTCGCTCAAACAAAAGTACTGCAGCAATTCGACGGACAAGT
CCAAAAAGCCCAGTGTGCACAGCATGCACCAACAAGTCCACGCAATGCTGCTGACGCTGGATGTGTCGAGCATTCCTTACACCGCCGATGACTGGTCCCA
ATTGTCGGCCACAAAATTGCCTTCCTTCTTGACCGAAACAATCAGCTGGAGCAGCTGGAAACAAGTGTTTGCTATCGAAGACGTGGACGATGCAACTGCC
ATGAGTGAATCCGCGTCCCACCAGAAAGCTCCGATCTTGCCGGCTGGTGTCGGGTGGAGCGGCCTTCCCATTTTGCACGGAACGGCAGTCGTCGTCGAAG
CGGAGACTCATATCGTGACAAGTGCCGGGCCAGTCCCTGCTGCCGAAACCATTGCGGATCCATTTGCCCCTGAACATGACGTTGGCGGCTTGGTTGTCGC
AGCGCGACCGTTGTCCAAAGGTCGATGGTATTGGGAGATTGTGTGGCGCCACCAAGGTGCCTATCCCATCTTTGTCGGTGTCAGCAATGGGTGTGCCAAT
GTAAATCAAGCGTTCGGCACCGACGGTAACTGCGGCACCGTGGGGGTGTTTCTCGGCAAGGACAAACTACCCGCGACGTCGAGCGCTTATTACCACCACA
TTTCGTCCCTCTATCACGTCTGGGCACGGCTGCAACCGATTGGCGTGCTGCTGGATTGCGACGCCAAAACTCTGGATATTTTCTGTGGTGTCAAGCGCGT
GCACTCGCTGAGTGTGGCGCACGCGACCACGGCGGCGTTCTTTCCAGCACTTGGCCTCGTGGACGGCGAAGCTCAATGGGATGTGTACGCTCCAGTCCCA
GCCCGTATCTGGTCCACAGCGCCAAAATTCACGTTTGTGTCTGGTGGCTTGGCGTTGGATTCGTTTGGTGGCAACGCACTGAGCTGGAATGGGCGAGTCA
AGGGTCCGAATCTCCACCTGGCCGCGGATTGCTCGACCGTCGTGGCTGGAGACTGTCTGTTGGCGATGCCGCAAATCGAAACAGTTGTGACCAACAAAGC
GTTCCAAGACGGCCAGTTGTATGTCGAGCTGAGCGTGTTGGCGTCTCGGCACCGCGCGCATTTCGTGCTTGGTATTGTGGACACTTCGTTCCATGCCGCA
CATGAAGCCATCGAGGGGTTGCATCTTGAATATGACGAAATCGAACAGGAACACGACGGCCTCCTGGGCATCCTCTTCGACTTCAACGAAGGAAAGCTCA
CGGTGTATCAAAAGCGCAAAGAAGCGATTGTACACTCGGTCGATGTATCGGGTCTCACACCACCGTACGTGCCGGCGCTCTCTGCGCTGTGCAATGGCGC
GATCTTGTTCACAAACTTTCACCCACACGCTCGACCACAGCTGCCTCCGTCGTCGATTTATCCCTTGGCCAAAAGTACCGTGGCAATCTCGTCCGCGACA
GAGAAACAAGTGGGCAAAGTGCTCGATTTCCAAGTCGTGACGTGCGATGGCGGCGAGTTTAGCGCGTCCCACGCTGTCAACAATGCCCTTGTAGACGACT
CCACTGTTTACAGCTCGGCGGGTTCGCAAAACATTTCGCTCGTTCTCAAGCACGCCACAGACACACCGTTTAGTATCACGTATGCCATGATTCGCGGTCC
TGGGGCTGGGTACACGGCCCCGCTGCAGCACGCGCTCGTATTTGTGATGAGTACGCCACCTGAATTGGACGAGCTCGAGCAATACAATGGCCTCACCCCA
GAGGAGTTTGCCGGGCTGCCAACCGCCCCGTCCGACGCTCACGCCAAGCGCGACGAATGCATCCCAGTGTTGTACTTTGTGCTTGACGGCAATTGCTCGT
CCGCGTCGAAGCGGTTGACGGTCCCAGTCACGGGGAGGTATGTCGTCGTGAAATTGCTTCGACCAGCCAGTGGCGGAAACATCGATGTCGGCTACATTGG
TTTTTGTGGCGCTTTCGACAAAGAAAACGGACCGGCGTACTGCGACTTGTACTGGGACGACTACTTGTGTACAGAGTGCCACTTGTGCCCTATTCCAGGT
ATCTGCTACGTCAGCGAAGAAGACGAACAGGCTAAATTGTGCTCGAGTTGCTACGACGACCAACGCGGAGATGTGTCGGCGTCGTACTACGCGTGCGTTC
CGACCGACGACGAGCATCGAGGTGAAGTTTCCACGTCGGTGCGCTGCGCGCCTCGTCAAGCTTGGTTGGAGTCTGTCGTCGCCTCATACGAATCAACAAA
ACTCTCGACACCGAGCGACCGCCATTCAGCCAGTCCTGCCAAACCGTTCGCTCCAGATGAAGTCTTCGATGACGTCGAGTTGTTTGCGTGTGGTCAAAAC
AATTATGGCGAACTCTGTCTCGGCCATTGCAACTCGACGAGTAAGCTGGAACATGTTCCGCTGTTCACGGCCAAGAGCGTCAAGCACATGACGGGTGGCA
ATGAAGTTCTTGCCGTGGTCATGCGGGACGGTAGCGTGTACACTTGTGGGCTGAACAAGAGCGGTCAGTGCGGCAACGGCACGTTCGAAGAGCGCGTCGT
GCTTGCAACACCGGTTCGTGCGCTGGCAGGCATTCCCATTGCCATGGTTGCGGCTGCGAACGGATGTGAGCACATGATTGCTGTCGCTCAGGACGGGTCG
GCGTACTCGTGGGGATACAACGATCGCGGGCAACTGGGTCTTGGGTCGACCATTTCCAAGAGCCACACGCCAAAATTGATTGAGGCGCTCCACGAAAAAT
ACGTGATTGTGTCCGCCGGGGTGAGTTATCATCACAGCGCCGTCGTGACGAGCAACGGCGAGCTCCTGACGTTCGGCATGAACGACTGTGGTCAACTCGG
TCTCGATCACACGCAGCACCAACACACGCCACAGATAGTCGATGCCTTGGCGAGCCAAGTCGTGACAAACGTGTCGTGCGGCCTGTACCATACCGTCATC
ATCACTGCCGGTGGTGACGTTTACACTTGTGGAAAGAACGATTATGGCCAACTTGGACTGGGTCACTCCCGCAGCGTCAAAGTGCCGACGCTGATGAAAC
TCAGCGACAGCGACGACAAAGCCGTGAACGGATGGAGCGGGTATTACCACACCAGCGTGATCACGGACAAGGGTAAATTGATCACGTTTGGTCGCAACGA
CTACGGCCAACTCGGCATTGGCAGCAAGGAACATCGCAATTCGCCGCACTTGGTTCCGTTGCCGGCAGGATCGAAGGTCACGTCGGCGGCGTGCGGATGC
TACCACACGTTGATTTTGCTTGCAAATGGACGGGTTATGGTGTTTGGACGCAACAACAAGGGCCAGCTCGGCGCTGGCGCGAGAACGTTGCCATCAGCGG
ACCTACCGCTTCCGATTCCGTCGAGCGCGCTTTCCAACGACGACGTTGTGGCGATCGCTGCGGGCTTTTACAGCTCGTATATTCTCACTGGGCGGAAAGC
AGACAATTCGAGCAAGAAATCGGGAACGTCTGTGCGAGATGAACTCAAAGACATGCACGGTCCAGAGCACCAGAGCGTGAGCTCGGAGGCACTTTTCGAG
TCGCTCATGCGTGAGATGGACCGAAATTCGTTGAGCGACACCCCCAACGACACGTCGCCGCTGTCGCTGAAACGAAGCAACACGTCCAAGAAGCTGCCGT
TGCTAAAGCTCTTGTCAGGAGCTTGGGCCATGACACGCACGCTCATGTACCAGTCGCTGCAGTCGAAAAAACCAACGGAAATTCTCAAGACGTTCATCTT
GTCGATGCTGGCCAATCTTGCCGAGTCCTCGAAACATGCAGACGCTGTGGCGACACCATCTTCGACTGGTGCCCCTTCCACCGATGACGAAGGATTTTTC
AACCTGTCGGACGCGGCGGTGGGCTTGATCAAGTATTGCGCGTCGGAAAAGTCCAAGTCGGATGGAATGCAAATCCCGTCTCAGTTGTTTGGCAACCAAG
TGTTGTGGGTGCTGCTGACTTGCGGCTCCGTCCACGCAGACGTCTGTTCGGTGATGGCAACGTCGTCGGTGGTGCTGCAAGAGATCATCCGAGGCATGTT
GTCATCGACGCTGTCGTCATCTATTATCTGCATGCGTCTCGGCATGCTCATCTTCCCGCTGCAGTCCGTGTCGGCCGTGAACAAAGTGTACAAATCGATT
GCGTCCATCTCGTCCGACATCATGACGTTTTTGTTTCTCGTCGTGGGCTACCCCCTCATGCTGCGACCACCACTTTGCAAGCACGAGCTTGGAGTCGAGT
GCTCGACAACGTCGTTGTGCAAATACTTCAACTGCACCAAAGGCGTGGCGGTTGACGCCCCGATTGCCGCCGCCCTGTCGGCGATGGTGGAAAAGCACCA
CATCCACCACGCAAAATCATGCGAAGCTATCTCGCTCGTGCGATACCTTACCCTGTTTCCAACATGGAAAAAGGCTGCTGGAGCGACGATTGCTCGCGCG
CTGGAGAAGACGGATGTCGTGGACGACCTGTTGGCCACGATCTCGAAATTCTACGAGCACTTTGCAGGCGCGACGGGCGACAGTTTGCCTGGCGACGACT
TTGTTGACGACGACGTTGTGGTTCGGCAACCCGAAAACACGTCACCCGAGCATGATGACCCGGCCATCACCCCAGGACCGCGACCGAGCGATGGCAACTC
CACCGAGAAGGAGAAAAACATCGACGTGATTTCCGAGTCGCTATCGTTCGACAGGACAGCGGCAGCTCTGCGCAAAAAGGCAAAGGACGCGTTAGATCAT
GCAACGCTCTTGTTGGCGTCGATTGGAATTCTCGGTGGCCACACCGAGTTGCTTCGGGAAGGCGGACATGTTTTATTTGAAGACTTTGAAATGCGGGGTC
GATACAAAGGTGGGGTGCTGGTTGGACTCAAGAAGAGTCTTCGCGGTGGCATTGACGGTTGCATTGCAGTTGCAGACGACGTCGCGTTGACCACGTCTCC
CAGTCCGACAGACAACCCGACGCTTGTCGTCCCTCTCAAACATTTGCAACCCGTTGAACGCATCCCTGCGATTCCCCAAATGTTTGATGAAAACCTAAGC
GACGCCCTTCACGCTCTGTCCAAGTTGATCGTGCCAGCGTCGTCATCGTTTGCGTCGAAACTCGACTCGTTCAATCCTGTTGTCCATGCGAATGTCGGTG
TCGTGTTGAAATCGTTCAAGAATCAAATTCGGTGGCGGTCGACCAAGGCGCTTGCGTCAGTGCTCAAGCAACTGCCGTCGCTCGATACGTCCACGAGCAA
CAACATGGACGTGTCGATTATGTCCAATATTGCAGCTCTCCTGGCGTCGGAGAGCAGCACGACGGTCCAACGCCACGGGAACGCCATCGACGTGGATGAC
GACAGGCTCTCGTTTTTACACGCCAAGTGGTTTGCTCTCAAGGAACACCAAGCGTACTTGGCGGCCGAAAACGTGATTGATTCCGCCTTGGACGCAAGTG
AGAGCCACGTGCGCGACGAAGTTGTCCAGCGCCTCGGAAGTGAAAATGCACTCTCGTGGGGCATGGATGCGATCCAAAGTCCCAAGAAGCGGCAGTCCAG
CGTCATGGCCAAAGTCAATGTGAAGCCACAACAATCGATCGACTCGTCGTCGACGGCAGTGCCGCTCGGGGTGTGGGGCATGCTATGTCCTGTTCAAGTT
GCAGACGCTGAACGCGACCATTCGTTCAACTCGACCTTTCATCTGCGCTCGCCGGTCGTCCGCGTCGGCCGAGCCACCGACTCGTGTGACATCGTTATCA
ACGATCGAAGCGTGTCCGGCCGCCATTTTCACCTGCGGCGAGTGCGACAGGACGCAGTCTGCGCTGACGAGTACTTCGAGCTGCAAGATTTCTCGAAGAA
CGGCACGATAGTCAACGGCGTGCGAGTGCACGGGGCTAGCATCCGTGTTGCCCATGGAGCGCGCATCTCGTTGATTCTGTCTCGAGGAGGCATGATCACG
TACGAATTCCACGTCATGCCTCAAACTGCCTCGGTTATGGCCGAGCCTCTGTCGCCTTCAGGATCGGCTCTGTCACTGCTTCCAGCACCCATCGCAGCTG
CAAGCGCGAGCGAACCGCAACAGCAGACGCAGCAATCGGAGCTCCATGAGCCTCGAAGTCCTGCCGAGGTTCAAAATCGCGCAGCGTCCTCGGTGACGTC
ATCGCAAGTCAATACGAATGGCGTGATGATGGGCAACATTCGTGCCCGCTTGGGACCACAAGGACTTCGATTGATCACAACGATCGGCGAAGGCGATGTA
CCCCGCGCGCTCATCTCGCCAAATCCGGCCGTGGACTCTCCCAGAGTCGGTGGGAACCACCCGGTGAACCCGCCGCCGATCGCGATTTCTGTCCATTCGC
CGCGCACACCTGCCGTCGGGTCTCCAATGGCGTATCCTGCGTCCGGAGTGTTGTCCCCGGCATCCTTCCAACAACGAGAAAGCAGCGCGTCCCTCGCGCC
ACCGGTCCTGCCGCATGGGGAAATGGCCGTGTCGGAAGCCCTTCGAATCGCACTTGGCCGAGAAAGTCTGCACCGCGAG