Description :
From Genome Similarity Track
Location :
Scaffold_112:85180- 87107
Transcript NameFunction/comments
Physo_109469putative polyprotein
Physo_142340putative polyprotein

Sequence
1927 bases(100 bases per row)
CCGCGAGCTGGTCCTCCGTCGGCACGTAGTTGACGACGATGAGTCCTCGGGACACATTCTCGCGGATGAAGTGATGCTTGATGTCCACGTGCTTGGTCCT
CGCGTTGTACCCAGCGTTGCTTGCGAGGGCGATCGCGCCCTGGTTGTCCTCCCATACTTGGGTAGCTCCCACTTGCTCGTGACCCATGTCCTTGAGCATG
GCGCGGGTCCACAGCACCTCCTGCGTGCACAGGCTCAGCGCCATGTACTCAGCCTCCGCCGAGCTGAGCGCCACCGTGCGCTGGTACTTCGACTTGAAGA
CCACCGGCGCCCCGCTAATCATCACCATGATGCCCGACACCGAGCGTCGGTCGTCGAGATTGCTGCCCCAGTCGGCGTCGGTGTACGCCGCCACCTCGAC
CTTCTTCGCGTTCCCATTGTAGGCGATGCCGATGTCTTGGGTGCTCTTCAGGTACCTGAGCACGCGGATGGCAGCCTTCCAGTGCTGCTGCCCGGGGTTC
TCAAGGAAGCGCGACAACTGGGTCACGATGTACGCCACATCAGGTCTGGTGCAAGTTGTAATGTACAACAAACAGCCAATGAGTGCTCGGTAGGACTTCG
CCTGCATTTCCTCGCGTTCCTTCTGAGTCGTCGGCGACGGAGTCTTCGACAACTTCATGCCCGACTCGCACGGGTTCACCACCACCTTGGCGTCCTGCTG
GTTGAACCGCTTCACCACATCATCAATGTATCGAGTCTGCTTGATCATGAGAGTCTTCGCCGATGAGTCATGGTCGATCTCCATACCAAGTATAAACTTG
GCTTCGCCCAACTCCTTCATCTTAACCGCATTCTTGAGCGCCACGTTGACTTCCTGGATCTCGTTGCTCGTCTTGGCCGCGATGATCATGTCGTCCACGT
ACAGGCAGACATATACGAACCTGCCCTTCTCGCCCTTGACGTATACGCACTGGTCGCCACCGCAGCTCCGAAATCCGATGCCCCCGAAGACTCGGTGGAT
GGTCTTATGCCAGGCATTTGCCGCCTGCTTCAGACCATAGATCGCCTTCTGCAGCCGACACATCATGTTCTTCGCGTTGATGATTCCGTAGGGCACCTCC
ATGTAGACGCGCTCCACCAGCCCGCTGTTGAGAAAGGCGGTGTCCGCATCCAGCTGCTCGGTGATGTACGCCTCGGCCACCACAACCGACAACACCACTC
GGATCGAGTTCATGTTGGCCACGGGCGAGTACGTCTCGAAGAAGTCCACGCCAAACTTCTGCTTAAACCCTTTCGCCACCAGGCGGGCCTTATACCTGAT
GACTCGGCCGTGCTCGTCGCGTTTCTTTGCGAACACCCAGCGACAACCGATCGGTCGAGCACTCGGTGTCCGACGGACCAGCGTCCATGATCCGTTGTCC
GCGTGTGCCTTGAGCTCCGCGTTCATTGCCTTCACTCACTCCGACGACTCGTCACTCTGTATGGCCTGCTGATACGTGGTGGGTGCGTCATTGGCATCGC
CGACGTCTGCGTCGTAGGCCAGCACCGCCTCAGCCAATAGGCTGTTTTCTTCCACCCTGGGTCGCTTCGGAGACGGTGGCCAGAAGTGATCGTCGTTGTC
CGAGTCATCGGGACCATCTTCTTTCGGCTCCTCACCGTCTGCGGAACTATCTCCAAGTAGTAGTACCGGTTCTCGGGCACGCTGGGTCCGTTCCGGCTCC
GGATGGAAGACCATATCATCATTAAATACCGGTCTCGCGAGTCGTCGGTACGTGGTCAGCTCCTGCATGGATGGCTCCGGCGTCTCCGCCTCATGCATTT
CCGCGCCCTCGACGGTCTCTTCCACCGATTCCATCGGCTCGTCGGCGGCAGGTCGTTGCATCTCCTCGTGCAGCGCCACTTCATCGTCGACATCTTCCGT
CGACTGAATGATAGGCGAGTTCTCGCT