Description :
From Genome Similarity Track
Location :
Scaffold_184:85171- 86377
Sequence
1206 bases(100 bases per row)
TAACCAACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAAGTAAAAGGGGACCTGTGAACTGCCGTTCACTGAGAG
TTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCTTGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGA
CTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGCTCGAGTCGGTTCGGAAGATGGCAGGCATCTT
CGGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCTCAT
GTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGA
ACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTATTGCTTTTGCACTCTCCAACCTTAGCGG
TCGTGCTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGGAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGT
CCCTAGTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCACACGCACTCAGCTGTTCCAGGTGCAGTC
AAGCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCG
GCTCCCGGTCGAACAAGCCCCAACAGACCAGTTCCCATGGAGCTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGAAGGATGGGCCACT
TCAAGCGCGACTGTCCCGCGGAAAGACTCCGCACACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGAAA
CGCAGG