Description :
From Genome Similarity Track
Location :
Scaffold_1:851357- 854468
Transcript NameFunction/comments
Aphas_H257_00298Hypothetical protein

Sequence
3111 bases(100 bases per row)
ACATAGGCGCATGCGGTCGTTCCTGCTCAACTTCTTGGCGGACGACATCGGCACGTTCCGGACCGAGATCGATTTGTATCAACACGCCATCGACAGCGGC
CTCGCCGTCACGGACGCCGCAGTCCAAGAAGTTTCCCACCTAGTCCCGGGGCTCACCAGTCTCAAACTGAGCAATTGCATTGACGTCACGGATGCCGGCA
TTTGGTACAACTTCGTTCATTTTATATATCCATACCAATTGCGTTCCCAGCTCAATCTCGTAGCAATATCGCATCCAAACTACTTGCGTCCTTAACTCCC
ATTAGGTCGGTGGCTCGACATTGTCCTGGTCTCACCAGCATCTACCTGCGCAAGTGCGACAAGGTCACCGACCTTGGCCTCCGTGTCCTCGCTCATCAAT
GCCGCCTCGTCACTGTGGACTTGACGGACTGCGTCCAGATCGGCGACTTAGCGCTGGCGACCCTCGCCGCTGGCTGCTGGACCATCGAGACGCTGGTCCT
CGCGCGATGCGTGGCCGTCTCGGACGCTGGCATTGCCAAGATTGCTCAATGCTGCAAAGGCCTCACGCACTTGGATGTGTCCGAGTGCGCGCACGTGGGC
GAGTTCGGCGACAAGGCGCTCGTGGAGCTCGGCAAGTGGTGCGGCAACCTTCGGCACTTGGACTTGTTCGGGTGCCGCCACGTTCGCGACGCGGGAGTTC
GCGCCATCGCCACGGGGTGTCCGCACCTGTCGACGTTGAAACTCACGGGGTGCCGAGATGTGGGCAGCGGGTCCATCCGCGAGCTGGCCTACCGATGCCA
TGCGCTGGAGCGCTTGTCACTGGCCGGATGCATCCGCACCCACAACGACGACCTACTCCGCCTCGCCGCGTCGTGTTCGCAACTTAAATGGCTGGATATC
AGCGGCAGCCCCAACATTTCGAACCGGGGCATCGCCGCCTTGGCCCAACACTGCAAATCTCTCGAGCACTTGAACGTGTCGCAGTGCCCGCACGTCAGCG
ACAAGGTACGTACGTGCACCGTGAGAGCCAAGTACTAGGAAGGATGGTTATGGCTGGACCGAGCGTAGGTGCTGCACACGATAGCCACACACATGAAGTC
CATCACGTCACTGTCAATCATGGACTGTGCGCGCATCACAGAATCCGGCATCGACACGCTCACAGCTGCCTGCACGAAGCTCTTTACACTCAACATGACC
AATTGTCCCCGCATCCGACGTCGGTACCTGCATCAACTGGTCGCGCGGCTCGAGTATGTCGACTGGTCCAGCACGTATTTTGGCATTGAACCGTTGGCCA
ACGCCATCGAGTTGCAAAATCATGTGGGCATAGTGCTTGCTCTTGTCCATACATTGTTATGTAACACCTTAGCATTCTACAGAAAGAGCTGGAGCTTCGA
AAGCAAGCCAGCGCGATCTTAATTCAAGCCATCATGCGGGGGTGCTTGGCCCGCGGCGGCATCTACGGCGCCATGCTTCGGCGCGTGGTGCGGGATGTCC
TGCCCAAGATTCAAGCGCTCGTCCGAGGGTTCCTAGCGAGAGCTGGGTATCGCCGCATGCGGCTGGCCATCGTGCAGGAAGCCAAGACCCGTGTGATCCA
GCGGGCGTTTCGACATTACAAAGTCAAGATGCTCTGTCGTCGCGCTCGTCGTGTCATGCAAATTCGGCAACATCAAGACGCCGCCGCGTTGATCTTTCAA
AAGGTTCTACATCACACATTACTAGAGCATCGTAACGTTTGCAGCCTAAGAGTTTTATGATTGATGGCTCACATATTTGTTGTGTCGAACGATATGACGT
TAGATATTCCGGGGACATCGAGACCGACTTGTCGTTCACCGCATGCGAGAGGACCTGCGACGGATCGCTCAACTCGACTCGCGGCGCCAGGCCATGACGG
AAGTGGCGGCTACCCGGGTCCAGCGTCTGTGGCGGGGCCACAAGGGGCGTGGTGACGTGGCACTACGCAAGAAGCTGATCGAGTTGCGACGTGTCCAGGC
GGAAAAAGAGCAAGTCGCGGCGAGCTACTTGCAGCGAGTGTACCGAGGACACCATGGGCGGAAGGACTTTGCCAAGCGACTGGTGGAGAGAGAGAAGGAG
CGCATGCGGAACGCCCGCGCGATGCAGATTCAACGCGCGCATCGGCATCACATGGCGTGGGAGGCGCGGAAGGTGCGCTTGATCGAAGAGGCCGAGGCGC
GGAAGATTCGGGCGGTGATTCGCATTCAAAAGAACTGGCGCGGGGTGCGCGAGCGGCAGCTGGGCATGATCATGCTTGGCCTCGTGCAGCTGCGGCGGCA
AGAAGACAAGGCGGCGCGGACGATCCAGAGCATGTGTCGGGGCTACGTGAGTCGCAACTTTATGAAGACGATGAAGATGGTGCTGGCCGCCCAGGAAAAG
CGCGACAAGAGCCTCGCGTTGCTGCAGCGCATGTTCCGGGGGTACAAAGGGCGCGAGAGGGCTGAAGTCCACGTCGAGTTGCGCAAGTTGGAGGTCGTGG
CCAAACCTCTGTTTGTCAAGATTCAAACGTATGGCGCCCGCGTTGCCGATCTCACGACCAAGGTCGACACGTTGCGGCGCGCTCTCAAGGCGGACCAAGC
GGACGAAGCCGAATTGATGACCGAGCTGGACAAAACCATGACGATCAAGTCCAAGTTCCACGACTCGGCGCGCATCACAGGCGCCAAGCAGCGGTACCTG
ACGCGGTACTTGCAGGTTCAGTTGGCCGACCAGCTTCAAAAGAAGCGCATGGCTGTGGCCGTCCAGTCGCGCAATCTGGAGATCGCCGTGGCGGAGTGCA
GCGAAGCGGAAAAGCAACTGCGGTCCGCCAAGCGCGAGCTGCAACCGCTGACTGAAGGCGTCGAGCGCAAGACCAAAGAGAACCGGGTGACGCGGTTGCA
GGTGAAGGTCCGACGTGAGAAGAAGTCCGCGACGGCCATTCAGCGGCATTTCCGAGGCTTCCGGGTCCGCGCAGCGGTAGGCGAAGGCGCCAACCGGTGG
CTGGAGCTCTTCGATCCAACTTTGAACCGTAAGTACTATTACAACGCGTGGAGCCAAGTCCGTCGAATTGTACGCCCGCTGGCGATGGACATTTTTCACG
ACGAGCTTGTG