Description :
From Genome Similarity Track
Location :
Scaffold_14:85123- 105378
Transcript NameFunction/comments
Phymu_g1021conserved hypothetical protein
Phymu_g1022hypothetical protein PHYSODRAFT_474645
Phymu_g1023aspartyl protease family A01B, putative
Phymu_g1024hypothetical protein PHYSODRAFT_476843
Phymu_g1025CTP synthase, putative
Phymu_g1026conserved hypothetical protein
Phymu_g1027caltractin
Phymu_g1028hypothetical protein PHYSODRAFT_349450
Phymu_g1029hypothetical protein PHYSODRAFT_310135
Phymu_g1030hypothetical protein

Sequence
20255 bases(100 bases per row)
TTCACCAGAGGAAGACCGCGTACTCAATGATGTGGAGGACCAACGGCTGCGCTAGATATCGCCACCTCACGGgctgttcttcctctctAAATGGCTTTGt
caaagctgcagccaccCACCACCACAGCTCATTTGCCCAGCTCACAGCAAACGCTGacgctgacgacgatgtTATTCTCACTGACACTCCCAATTGCCGT
AATGCCAACACGTTCGCGTACACCACGAGGCGGCATTTCTCGCGCTCTGATGGTGGGAAATGCCGATGTAATGCTGGTTTCCACACCAAAGCCCAATCTT
GCGACAGCATAAATCTCACCTCAGCTCGAATCCAAGAGGCCTCCTCTAGCTTCTGCCAGAGTTCGTTCGCTGCCAAAAACAGCAAGTTAGAACTAGCTCT
GCATCCGCGTAAAGTCCGTCAGCAATTGTTTCTCTCACGTATTGTTGCACGAGAAGCCCCCGCGTTCAGAAGCAAAGCCACCAGGGAGTTGTTCTTGCGT
GTCAGTGCCAGTGTCAACGCCGACGAACCCGTTCTAAaacatcagcagcaaaacaatCAATCAAGTTGCCAACGTAAGAGTCTCCGAGCAACATCTAACT
CGCACATATGGAAACGTACATCGTGGTTGCGTTCAAATCGACACCGTCCTCGTTCAAAAGCCTACGCACGATGGCCATCCGACTGTGTGCTACAGCGTAG
AGCAATGCCGTCCATCTTTCCCCCATCATCACATTTACGTCGCATCTCGCAGCGAGCCAAGCATTGACGCCATCCAGATCTCCgtccgctgctgcgtcaa
gGAACGCCCGCTGCTGACAGGTCGTCTGCATACCGGAATCGGTCAGTGTACTGAAATGCAAAGGTGTCACTGAAGCGAGGGTGTGCTGCAGgggcaactt
caacaacaatGACTTGCGTAAATCGCCATCTATTGTCTTAACGTGTTCCCTGAGCTCGGCCCGTGATGGGAGGACTTCTaactccttcttcctcttcgcg
gagctcgtcgtcttcaggtGAGCCGATCGTGAACTTCGGTGAGGTGCCTTTCTTACCAGCTCGGGATCGAGGAGATAACGGATTTCCAGGCGGAGACGTA
GGGGACAGACTTCCAGTGTCGTTAATCTCCACAATCGTCTGCATATGTGCGCGTGACGTCTCTGTTGCCTCCGGAATACGAGACCACGTACGAGTTCGCC
ACTTGGTCCAAACCATGACAGCAAGTGCGACGCCCACCAGCGAGATGAGGATTACTTCTGCGATAAAAGCACCGAATTTCGGGCTTGACCGCTTTTCTGT
TGCGTCTGCGGATGAGCCGGTGGCCACATCAGCACTGCCTGTCGCCagtgccgttgctgttgcgtTCGATTCAGTAGTTGAAtagttgctggagctgctc
gaggaaGCGTTAGCAGTTGGTGCCATTGGTGTAGGTGTCGATTGTCCGTCAGTAGCTGAAGTTACAGGAGCCTCAGTCTCGGAATTTGGGCTATCAGTAG
TATCTGAAGAGGCTGGCGATGGAGTACTCGAGTTGGTATAACTTTTGCCTGCACAAAAGATTTTGTTAGTCAAATTTCGTCTAAACGTCATCATCCGGCA
AAGAACGCACCACAATCCGACTCGGCGAAGCCCACGCGCTGGTTTTCCATATCAAAGATCACGTCGAAGCCGATCATGGTGCTCGCTCCCAAAACTGCAC
GCCATTGAAACAGTCAGATAGCTCAGAAGTAAAATAATGGCGAGCTAACTAAGCTTACCTCCGCCACTGCGCTCGGAGAAGTGAAAGTTGCCGTAGTAAG
TCCCATCACTGTCGGAGGGAGTAAGATATCGTGAACCAGGGATATCCAGTTGAACGTCATCAGTGCCATCTCCTTTCATCCCCGAAAGTATAATAGAAAT
CGTCGGAAGAGCTGCTAACTCGTCGTCGGTAAGTTTCATGCGCTTCTCGCTGTACTCTTGCCCTGCAGCGTCCCGGAATGCTTTCATAAAGTTGCGATTT
CCTTTGGCGTCGAAAAAAGTGTCGGTTGTTCCGCTATCAACAATTACTCCTCTACCAGAGTTGATGGTCCCAGCGTCAATACCGAGTGATACGCCGTTCA
TCCGAATGTCCTTCACATGGACAGGATAATAGGCGGAGTTATCGTTCAGTAGCGCAGTGTAGCCCACATCACTCGTGTGGTGGCTGTAATCCACTCCACC
AAAGACAACttcgcctccatcttctgcaaAGCACAAAGTAAAGAGGTTGTGCGTCACACGTCCAGCACTTAGCATGTAAGACATGACAGTCGAGCGATGC
CTCCCAAGGCCCATAATACCATTCTCCTTCTGCGTAATGAAGAGACCAGTCTCTTTAGTCTGACAGCCAAGCGGAAAGCGAAAGCCAAACGTCTTCAACA
CGCCCTCCATTTCATCGCTCGGAGTGGAGAAGCCTCCCACCCACACCAACTCGTCAACCACAACAGCTTGCCACATGCTGCCTTCCATGTAGCTCTGTTA
ATTCAATACACCGCCATCAATGAGAGAAAGTGTCAGCACCAAACTCAACATCGAGCATTTAGATTGCAAAATCATACCTGCGATATCATGCAGCGGTCAT
TTTCACATGACCGGCATGAGTCGAAGTCATGACAACCTAGATACTTTGCTGTCGTGGACTTGGACACGTCAAAGAGCGGATCAGTGTGTGTACCGCAGCC
AttgcacgtgctgcacgGCAAAGCTGTCAAGTGGCTGCCTGTGTCTAGGATCACGGAGGCTCGTTGTGCAGGGATACCCAAGTAAATCTCAGCATAATGT
GTGCTGCAAAGCAAGAAGCACCGAATTCCATGTCAACTCCTTTACCGGTATCCAGATCTATTCAATGCGCTGTGCACGCACCCGTAGCCCACACCCAATG
GAGCTTCACTCAGGGCCAACGCAATGTTCTTATCGCCAGTAACTGCCCCCTCCTGCGCTCTCCGTCGACTTCGAGCTTGTTGGTGAGCCATCCGGTGGGA
CAGATCCGAtctcgactgctgcttgtgaaGCTGAATTCTCATGAAACTCTCCTCGCTAGCGACTGCGACACACACTTGAGAACATGCTAAAGCTGCCAGA
GCAACCGCAGAGGCTCGCCATCGAGCTCCATGCTTCGTGTGCCGAGCCTTCATAGCGGCGATGCTTTATCTCAGACTGGGGGCATTGCTGCAGACGTTAC
CGCGGATTTAATTTTAGCCAATTGAAACGATAGGATCGAAAGAAGATGCTGTCTTTATTTGTCggacatggctacattttgTTTCTCTTTGTTTGGACGT
GCAACTTGGGTATCTTTATTTACTGGGCAGTGGCGAAATACATGATCCGTTCTGTGTTACTCAAAGCCGCTCCAATGTTCGGTTGTCCACCTTGGTCTCC
TGTAGAGATTTCCGGTCAAAGacttcgtcctcctcgtcactgcTACTTtgctcgtcatcgtcgtcgtcctggtcAAGCCGCTGGTGCTTCGCTGTAGGCG
CCGATTGTTTTTTATCGTTGCGAACGACACCGAactcctcttcgtcgtcatcgtcctcgtcctcctcgtctccTTTCACGCGACTCCAGAGCTGCTCCTT
GCCGGTCTTTTGTTTCCGTCGACTTACTGAAATCAACATCATCACCAGAAAACCAACGACCAAGACAGCACCCACGATAGTCAGCACCAGTGGGTGAGCG
CCTGAGgactccttctccttcgcaTTGTGatctccagtagctgctgaGGAGGACTGGGTAGTTGTCGTGGTTTCCTCTGACAACGGCTGAATGATCTGAT
CCGTAGTTGAAGCAGCATTCACCACTGAAGCGTTCGCTGTCACCTCTGTCGCAGCAGGAGTTGGTGCCGCCGTTGCAACAGGTTCAGAAGTTACCGTGGC
GATGGGCTCGGGGGTCGTTTCCACTTCAGACGCAGCCGTCGCAACTGGCTCGGAATACGTGGGCTGCGGCGTTTTCAAAATGACTGCGGTCGGCTCAGTC
GGTTCCGATGTCGTGGCAGCGGTCGGTGCTACCGTGTCAACTACTGCTGGTGTAGTGCTCGGAGCGGCAGCGGTTGTAGCCGTAGGAACGACGTTGTTCA
CCTTTCCTTGAGAACCACTCGTAGTACTCGTAGCACCCTTGTGAATGGAAGGAGGCGCTGTCGTGTTGGCACCTCCTTGGAAAGCGCAGTCAGCATCCAC
GAAGCCAACGCGCTGATTACCAAGATCGAAGATCACGTCACGGTTCATCATAAGGTTGGCTCCAATAACACCGCCAGAGTTCTCAGACAGATAAATGCCA
CCACAGTAAGCACCATTTGACTCGAGCAGATACTGCTCAGGTGGCACATCCAGAATCACTTCAGCATTTTCGTCTCCGTAAGCCTCCATCACGAGCTGGA
TAGTAGGTAGCGACGCCAGGTCTTCGTTCGTAAAGCCCTTGCACGTTGAGCCAACCTGATAGTCGCGTCCCGTAATCTCCTTGAACATCTGCAGAAATTC
CGTCTTCAAGGCTCGTGGGAGATACGAGTCGGTAGTTCCACTGTCCACAATGTAGTGACCACGGCTGTATGCCTCCTCCTTAGCGTTGATGGACTTGCCA
CCAATGCGGATGTCTTTCATGTGTACATTGTAGAAATGGCTGGATCAAATAGCGCAGCAATATAGTTAGTTTCACTAAAAGGATCAATCGCATTCCTGTA
CAAACAGCCCATTCTTACCCGGCAGAGCGGTCTGAAATCACTTTCGCGTACGAGATCTCACTCCGATGAGCAGCCTTGTGCGACTGCCCAACAGACATAG
TACCGCCGTTTTCAGTAAAGCAGAGCGAGAACAGATTGCTGGGGATCTTGTTCTCTCGGTGCAGCTTCGCCACAATGTGGTTCTCCGTGTTGGACAGTCC
CATGATGCCATCCGCTACCTGCGTGACAAACAACCCGGTCTCCGAGCTCTGGCAGCCGAACTGGAAGTGCGTTCCGTAGCGGTTGCGCATGGCCTCGTCC
TGGAGGCTAGACTCTCCTCCCAAATACACGACATCTTCAACCACGGAGGCCTTCCAGCTGCTTCCTTCCATGTACGACTGGGAAATGCCGCAGGTGTCCG
ACTGCAGCTTGCACTCCCTGCACTGGAAGTACGACCGCTGCGCACAAGTCACGTGGATTAACGTAGACGAGTTGTCGGCCTGGAACGGCTGATCTGTGTG
CGAACCGCAGCCATCGCATCCCGAACACGGGAACGCCATCAATCCGCTGCCTGTATCCGCGATCACAGAGGCTCGCTGAGGCGGAGTACCAGCGTACACC
CACGTGTAGTGCGTTCTGTATCGGTCACAACGTCGTCAGAAATTTACAACTACGCCCCTATCACTGTATTTCAGATCGTACCCGAGTCCTAAATGCAGCG
GCACGAGCTCCGGAGCGTCTTCCTCAATGTTCAGGCGTCTTACGTATCTCTCCGGGTGGATATCATGTTTGGGCAGTCGGTGCAGCTGCATGGTCATGCC
AGCCTCTTGCTCGGCCTTTGCCAATGCCGAGAACGTCGAAATGGCCGCCAGAATCACCGGAAACCCAGCGATCACTCGCACCATTCTTACTGAAGTATTG
ATCGCTTTCCTGATGGGAATACTGCGCTGTGGAGAGTGCTGGAACGCTGGAGAATGCTACTGAGCTTAGCTTAACAGCCGAGAGCACGTGTGacgcgagg
aagagagcTCCTGATCGATGGGAGAGCACCTTGGCACGTGGCAGTTTTCCCACAAGTGACTGCTTTTTAGTCCCCTTGACCTGAAACGACGTCCTCGACC
CCAAATAATTGAGCTACGAACCTAAATTTGGTCAAATGGtccgaaaaaaaaagtatcttaTCTCCGAGCCTTTACATCCAAGTTGCTGTCTCTCAGTCCG
AGCCCATTTTGCGCCGTAGCAGCGTTGACCACGCACTGGTGCCACGACGTTGCCGAGGTGAACGTAACTCGTCGTCTGACCTTTTCTTGGGGCTCGGCTG
CACTGAAAACTCCCGCAATGTAGCGGTGGAGTCAGCCATTCGATTTGACAGTCCAACCAGAGGAACCTCAAAGCGAGAACGGGGTGATACGCCAGCGTCC
GCactctttttgctgctgtgctggacgaagagatcgtGGCGGATTtcgtccagtagctgctggcATTGTGGAGATACCACGTGTCTTGATGCCATGAAAG
CGTTGGAATCCGCGGGAAGAGCTCCTTCGTTGTCTCCACCACGGCGATGTTGGGCTAGGAGGGCGGCAGCCTTTGGTTCTACCTGTGAATCATCAACGAG
GTTTCCCTGGTTACCGTTGTCGAGTTCGCTGATCGCAGGGTCAGCATCACCTGACGTTACTGGAACTCGGTGATGCGGAGTTGTCAGTTGGTCGGTCGAC
atgacgaggagctcacCTGTGAGCTGTAGGTCGGCTTTCACTTGATCCGCTCTGTTGTTGGGGCCATGAGCAAAAGGAGGGAAGTCGCGCTGCTCAGCTC
GGAGGAGCTTGTGTTGACTCCAAGCAGCCAGAAACTCCACTGCTGGCAGCAGTGTTCGGTGATCCTCGAGACTCTCGTCCACCCAGTCGatctgctgcaa
ttgccgCTCGAACTCGAGCGATTCACCGGAGAGCACTCGCATCTTCTCCGCGACGGCATCGTCCAGATTTTGCAGAGCTTGTTCGCACTGCTCTTTGATG
GCAGCTGCAACCTGCGCCTTGTTTTCTTGGACGCTACGTTGAATCCGAGTCAAAACCTGGAGCTTGTTTTCGATCACGGTCTTGCGCGATGTGATCAGTG
GATCGGGGCGCAGTGACTCGCGTATGGAACTCTCATAGGCATCAACAACGGTCAACAGTCGATGAGACCCCTTCTCTCCGATTGAGTGATCTCCGACCAT
TTTACAGGTCACGCACACGGGAACTTGGCACACGGGGCAGTAGaactccaccttcttgtcaTGATGCATGCGGCACGTTGGTGTCTGTGTATCATCGGTG
GATAACCCATCTTCCAGCTGCTTAGCAACGATCTCGCTGACCTGCGCTTCCGTTAGTtccgtgctgcttggaggtGGGGCAGTGTTCAAGAGATTTTCCG
ACCCAATCTCcgcgatggcagcagctaGCGATGGCGCCGAGCTACGACGTCTACCGCGTCTAGCGCCTCCACTTGCTACTGTCTTTGACTTGCTGCGTAA
TGGCGTGCGCTTGTGACGACGCACCAACTTATTAGCCGAGTGGACTTCTTGATCACATTGGGCACAGATCTGAGCTTCACAGTTGCGGCACAGGACAGCC
GCAGGATGTTGCTCACAAAGAGCGCAAGCACCAACAGGACCATGCGCGTCGGCTGCTGAGAAGGTGAACCGAACGAGGTACTGGGGTAAGATTTGGAGCG
TGTTGTTTAGGATGTACTCGTGATAGTAACCGCGATCGAGAAGTGCATCTTGCACGTTGTGATCTTGATCAGagccagcttcttctccacgatgcAGGTA
GTAACTGTGATACCCAGATGGGAGCCGTCCTTTAGCCTCGTCCTCCCCCCGAATGACAAGCGATCGCCCCACTGCAATCTTACAGAGGACAAATTGCCGC
GTACTGGATGGTTTCTTCGCTTCCGCGGACTGGTCTAAAGGCGCACTAAGTTGAAGGTTTCCAGTGGTGAATTTCATTCCCGTTTGGTTCTCGTCGAGAG
AGGTAAAGCCGTAGCTGTGGACGTCGCCCATGTCGGCACCAATGTCGTTCATCGCAACCCAggactcgagctccagcagcccTGTTGTGTGCTGTTCGTA
TTGGGCCACGAGCGACGGGTTCCGCATATCCCAAATCACAACACCCTCGTGCACACGATATCCAGGCAGCGAGCACTGCAACAGGTACTTAACTCGTGCA
AACTCCTTCGACGAGTGACTCATGGGCGTCACGCTCGCCACTGCCCCTGCAGCAGGGATGGTAGTCTGcatctcgtcttcttcgtcatccacgACGATTT
caggacaagaagcgacgTCAGCCCCCCATTCAGAGGAGGGAAGTGGAGTCTCAGACTGCGAGCTTTCGTCTCCCTTTGGCGGACGCTCTGGCGATGCCGC
TTGGACATCCCCTGGCCCATTGGGTGCATGCGACGACAGGAACAGCCTCAACCGAGCCAACGACGCATTTGCTTTCGCTTCCTCAGCCTCATTTACTACC
ATATTGGGAGTCTTTGCTTGAGCTTATTCCAGTGTCAGAAAACGTAAGAGAAACCAGTCGTTTCAAGGGGGTGTCCTTTGGCTACTACCCGCTAGGAATA
CAACTGGATCGCGCGTAAATCAAATGCATGGTTCAACCATTGGTTGGGgtgaactgcagctcgccaTTCACAGCCAACGCAAAATGGCAACTTTGCTTCA
ACATGTAACTTCAACGTTAGTTTAGTTTaatttttgttttgttgcAACCAAAAGTGCTTGCGTTTTTCAACCTGCGGCTACAGCAACCACCTTGTTGCTA
CTAAAGGGTTAACCACAACTGCCTTGAGACCCGTGTTTCAATTCCTCATACTGCCGGCATCGTGTCAAGAATGTACGAGCGCAATATCTACAGCCTGCAA
TTCGCGCTACCGGTACACGAATCGCGTGCGAGTGTAAGCGTCGGAtagctaccggtacatggAGTTACCAGGCCATTACAACACCAGGGACGTGAGCAAC
TTCCACCCGATCACGTCTGAAAATCATTTACCGCGCCAATTGGGAGTCCGCTGTGTCGTTCCCGCCACCTCCAGGCGTCCAACCAATTTGCCTGGCCGTT
TTCTAGCACATCCAAACGGGTCTCCACTGAGCCCATTTCCCATACAAAAGTCAGTCGTTTTCTTAGCGGGTTTGAGCCCGTAGCTCTTCGCAAGTCAAAA
AGGCACCAGTGCAGCGCTAGCCATTCGGCCATTTGTTGCCAGCAGTGGAAGTCGTTCGTCCGTCCCTTCACTCTCTCACCATGAAGTACCTGGCAGTGAC
CGGCGGCACCGTGAGTGGCCTGGGCAAGGGCATCACCATCAGCAGCATCGGCGTCGTGCTCAAGTCGCTGGGTCTGCGCGTCACGTCCATCAAGATCGAC
CCGTACCTCAACTGCGACGCCGGCACAATGTCTCCGTTCGAGCACGGCGAGGTGTTCGTGCTCAACGACGGCGGTGAAGGCGACCTGGACCTGGGCAACT
ACGAGCGTTTCCTGGGTATTACGCTCACGCGCGACCACAACATCACCACGGGCAAGGTGTACacgcacgtgctggagaaggagcgtcgCGGAGACTACCT
GGGCAAGACCGTGCAGGTTGTGCCTCATGTCACCGACGCCATCCAGGACTGGATCGAGCGCGTCGCCCAAATTGGCGTGGACGGCAAGCACGCCGGCGAG
GCGGgcgcagtggacgacgaggaagccgaCGTCTGCCTCATTGAGGTCGGTGGAACTGTTGGTGACATTGAGAGTATGGTTTTCCTCGAGGCTCTGCGTC
AGTTCCAGTTCCGTGTCGGTCCTGAGAACTTCTGCCTTGTTCACGTGTCGCTTGTCCCTGTCCTCGGCTCTGTGGGCGAGCAGAAGACCAAGCCCACGCA
GCACgccatcaaggagctgcgtaGCGCTGGTTTGACGCCTGATGTTATCATCTGCCGTAGCAgcacggagctggagcccGCCACGAAGGCTAAAATCGGC
ATGTTCTGCCAGGTTCCAGCCAACCACGTGCTCTCTGTGCATGATGTGAGCAACATTTACCACGTACCGCTGCTCCTGTCCAAGCAGGGTGCTGCTAGCA
TCCTGATGTCCAAGTTGCAGCTGATGGACCGCTTCAGCGAGCCGGACCTTGAGTCCTGGTCTGCCATGGCCCACCGCGTGGACTCCTTCGAGCAGATTTG
CAAGATTGCGCTCGTCGGCAAGTACACGGGTCTGCAGGACTCGTACCTGAGTGTCATCAAGGCGCTCAAGCACGCTACCATGAAGTGCAACCGTGATTTG
GAGATTGAGTGGATTGAAGCTAGCGAcctggaggtggagatgCGTGAAAGCAACCCTAAGGCCTACGAGGAGGCGTGGACCAAGCTGCGCAGTGTGGACG
GTATCGTGGTGCCTGGTGGTTTCGGTGACCGTGGTGTGGACGGAAAGGTGCTTACCGCCAAGTACGCTCGTGAGAACCGTGTTCCGTACTTGGGCGTTTG
CCTGGGCATGCAGGTTGCTGTGATTGAGTACTGCCGCAATGTTATCGGCTGGAAGGACGCTAACAGCGAGGAGTTTGACGCGAACGCCGGACACAAGGCG
GTTGTTTTCATGCCTGAGATTAACCCGGAGGTTATGGGCGGCACCATGCGCTGCGGTGAACGTCGCACCATTGtgcacgagaaggaggacccGGCGAAGC
GCTCGCTGGTGTCTTACCTGTACGGCAAGGACAAGCCGATCCTGGAGCGTCACCGTCACCGTTACGAGGTGAACCCGGAGCTGGTGCCGGCAATCCGCGA
GGGTGGCCTCAACTTTGTCGGTACGGACACCAAGGGCGAGCGCATGCAGGTGGTCGAGCTCGACCGCGACGTGCACCCGTTCTACTTCGCCACGCAGTAC
CACCCGGAGTTCAAGTCGCACCCGAACGACCCGTCGCCGCCGTTCCACGGCCTGATCCTGGCTGCTACCGGCCAGCTCGAGAAGTTCatgaaggacgtgg
agaccaaggagcaggagctgtaAGCGAGTGCACTGGACTTAGAGGTGATGGGAATTACTGCGACTCAAGAGCAGGTGTACGacagaagcaccagcggTGA
TATCTCTCGACGTGGAGCCGCAGGTTTGCGTGTGAATAGGCTAAAATATTGATTTGGACCCGTCCCTCCGCTGCTTTTGCCTTCGTTTTTCTTCCGTCGA
AGGAAAACGGGGCGAAGCTCTCGCGGTGGGATTTCATGTCCACAGTAGAACTAGACACCAATACAATTTACTTTATTTATTCCAatccttctccttttct
tTTCTTATTCTCTTTttgctgacgtacttgaagacatggctacacttgcCTCAGATGTAGAAATGTATTTCAACGAATCAAAACGCTTAGAGTGGCACAC
AACGTGGCACATTCCAAGATgactgaagagctgcaggaggcgGTGGACGGCTTCTTCTTAGCGGCGGAGTATGGCCGTTCCGACGTCATCAAGGCTCTGG
CAGACCACGGACGCGGTCATCTCTCTCTGGCTGACGTGGTGGACCCTGTTACTGGTCGCTCCCCGCTGCACGTGGCCGTGGCGagtggcaagaaggacgC
TCTGCGAGTTCTTCTGGCTGCTGGCTTCCCCCCGCAGCATCAGAGTAACAAACAAGAGGGTAAAGAAGATGGCAATCGATCTGCTTACGCGCTGGCTCAA
GATTTGAAGGCGCAGGATCTGATTCTGGTGTTCCACCAGTTCTTAATCCAACAAGTCGCAGCCAACGACGTCATCAGTGTCAATCAATTACTGGAAGCTG
GTGTGGATGTAGGCGTGACTGATACAGCTACGGGCGGATCTTTGCTGCATTGGGCAGCGTCTTGCCAAGCCGTAGATGTGCTGAAAAACTTGCTGGAGCG
AGAAGATGtacagaagcagaagctggtaAATACTCGTAATGGAGAAGGCGCCACGCCGCTGCACTTGGCTTGCCATGCAAACCAAGTCGAATGCACGAAA
CTGTTGTTGACGCACCATGCTGATGCAAGTTTGAAAGGGGAGGAAGGGATCAGTAAGGATAAAACGGCGCTTGAGTTGGCTAccaaggaggaagtggcgg
agTTGTTTTctcaagagcaggaaaacAGCGGTATGGTTGATAAACCTAAGCTAAATCCGCTGGAGAATGGAAGCGATGCTGATAAAACTACAGGAGAGAA
TGGAGAAGCGACATGTGGCTCGACGGCTAGTGGTGAACGACACGGATCAGGAACCTGCCCGCATGAAATCCAGAGTGGGAAATTACatttgcagctcgaa
gagAAGGACCTACTTGTCAACCAGTTGAAAAAGACCATTGAAGCCCTCGTACAAGAATCTCAGGAAATACAAATGCTTGGAGAAAACCGCGTGATGCTCG
ACTATGTCCGGAAACTGCGTGATGAGAAGGCCGTCGTCCAGAGGCAGCTCGAAGATGCTAACGACTACATTAAAgaccaacagcaacagcttgacAGTtt
gaaggagcagatccgacAGCTAGCCACTGCAGAGAAGCAGGTACGCAACGGAAGTCTTACGCGTTGAAAACGTGGGTATGTTCTTAACGGCACTTATATT
TTTGAAGCAGATTGAGACTGACCACGACATTCTCTCTCATGCCAGTGATGGCACGGTTAGCAGCATCACGGGTGGCCCTCCGGACAGCACCCACAGTAAC
ATGAGTCTATTGGATTTGCATCAGCTCGAGAATCAAATTGTTGAAGAGGATGATGGACCCCAGAAGCCTCAAGCCCAGCCGTTAAAACTTGATGCATGGA
CGTCCAAGGCGCAGCGTGAGCAAGAAACTTTCAATCGATACGTTGAAAAGCATGGCCCTGACATCTGGAGCACTGTGTGGAACGGTATCTGGACAGGAAA
TGAAGAAAGCGAGGCGCAGGATGAGGATGACGAGGTCATCATGACGGTGTAGAATTAATGGCCAATTGAAGAGCAAATGGGTTGGATTTTTTCGTAGACG
AAGAACCTAGCGGATCGGTGAGGTTCCACTTGGAGTGtcttgccgttgctgctgcttgtacaCGCTAGTGAGAAGTTTCTCACGCTTTTTAGGCTGTTTG
TACAGCGCACAGTTATTAGCACAAATCGAATTTGCCCCAACTTTACCACAGGAGCAGAGAGCTGGAGCACCAATTTGTGCTTGAAGAGCTTTAAGGAACC
GCTCATGCTCAGTCGCTGCAGTTTGACGTGTTGGACGCTTCTTGGCCGACTTTTTCCTCCAAGGCGTCGACGATGTGGCAGCTTGGCGATGAACTCGCAC
GTCACATCCCGCCGTCATATCGATACTATTCAATGGCGTTAGTTGTACAAACGTAGGTAAGCATTTTGTACTTCACTTACACTTTGACGGCTGCCCAGCG
TTCCCCAATGTCCTTATGCTCTGCATTACCCGTACGACGAGACCTACTGCCCCTtacagctgctgcaacggaGTTGTTTGACAGCGGAAATTTGACTTTG
TTGGAGTTGGGTGGATGGCGCCAAACGTTGTTTTGGACTTTAGCACGATTCATCTCCATGTACTGCCGTCTCACTGTCGCATACAGAGCAATTCGCTGAA
GGACGAAGATAATAGTTAGGTCAAAGCTTGCACTGGTACGTGAAGAATACTAGTACCCCCTTACCTGCTCTGGAAGCAAAACGGGTGATGCTGCCGGTTC
ACATTCGCTATTGCTCTTTTCGTAATCGGGAAAGTTATACGAACGCGAGATTTCAGTTGATCGAAGTAAATCATCGCGGATCTGAGCGTCTGCGTGCAaa
atctacatgtagtgcatTGGGTAAGTAGAAGACCTCGCATTGCTCAGAAAATACGCGCATTATACCTTTTCAATATGTTTCCCCAATGGACAATCCTAAA
CAACCACGAACATCACGAGAAAATACTTCACAAACTGTTCAAGTGCCACAAGACGCCCTTGAGTACAAACCTTTAATATCACTGTCGTATCTTCTTTCAA
TTTTTGAAAGAATTCACCGGTCGACACTCGTTTTACCGCAGTGTTTCTCGTGCGCTGTGTCACTTCTGTGGTCGAAAAAACCTTTGCACACTTTTCATCC
TACATGGCAATAATTAGCAAACCTTACACTTTgataaaaaataaataacAACGCACCAAGTGCTTTTGTACGCGCTGAGCTTCAAGGCGATTTTGCCGTT
CTCGTGCCGTCACGCGCATACAAATCTTGTCGTGGAATCTTTTTAGATCGTTTGACTGTGCGCGAAGTCGAATTTCGGCTTCCTGACGCATTGACTCTGT
TTCAGCCTGTGTGCGTCATCCGATTAGTTTACTCGTGCTCCCAAACTCGAAATACTTCAGCTTGAGCACACCTCGACACCTACGATATCAAGATCGAGCC
ACTCAGAATCCTCCTTGTCACCCATTCCCTCCCTGTAGACACCGCTACATACATAAAATGTTAAACAAAAAGCCAAGACCGAGGTTTATGATAACGTACT
TGTTGATAAACGCAACACCTTTGAGCACAAAGCTACCTGTAAGTATATCAAGTAGATACTTTAGGAACTATACAAAACGCACCATGCAGTCGTCTATTAT
CTCGCTCGTCCTCAGCAAATTCGCTCATTCTTTATAGTTCAAGCTCTAATACTGCTGTATGATCTTGAAAAGACGCATAGTCCAAACATGGATACACCCA
TGAAAAGACGCGTGTGTAGTCGGCAAGAGGATACGTAGAGCAATTGAGCGGCATGCCATTGACAGAGTACTATCACGTGCGCGATCCGATGGAGAACTTG
CTCATTAGCGTCACTCTGCGCAAGGTAAGGCGACAGTTTCGCAAATTTGAGCACTTGAATGTTGGCTGACTACGTCGTTTTGAAGCATAGGTCTCGGGAT
TTGGAAGCGACAACTCGGTGACTGTGGGGCGTACATGGAAGTATTGTTTCCAGTggcaagaaaaaaaactcagCTTGAGGTACGTTTAATAGCTCGGCTG
TCAAGAACAATGTGGCCAATAAGGAAATGTACTTTTATAAGCGAAAAgaagcaagagcaggagcgtTTAGAAGCGAGAGGAATTCAAGTATCCAACCGAA
AGGTGCGTGCACAAATTATTCTCACAGGACGAGCGTTTTTATCACGTTAACTGTTCGTATTTTATAAGCGTGGAGATAGAAACCCACTCGAAGGCACCGA
CGCCGATATTTTGTCTTCATACGTCGATATTGACGATTTCGTTCCGACTGAGGTATGTCCGCTGGAGAAAGATTACAAAGAATAACCTTAAACTTACGTA
TCGGTTGAATGCAGCAAGTGAAGGACCTTCCAAGTACATCGAAGAGTGCCCAAACGCACCTCATCCCGCCGGATCTCACCCGACGTCCACGCAACAAGCA
AAATGAACCCTCCTGGACACGAAACCACTATCGCGCCTGGCTTCGAGCTAACCGCGAAGATAAATTCCGTGCGATGCACATCGTTGCACTCGTGGAAGGC
GTGGAACGTGTGCTTTGCTCGATGCGATTTTACAAGGAAACGGGCCTATTCTGCGCTACACCCGGTTTCTCTGACCCAATTGTTGACCCTGAAACGGACC
CAGACCTGTTTCTCAAAGGACCCAAGCTTACAACGTATCATGTATCTACTCCTTCGGGTTCTCTGTACGAATACGTACTAGACAACGCTCATGACCTTCT
CCCATTTGCTTCCGCTCAAGACCAAAGACTTTCAAGAGACATCCGATTGCAGGAGGAAAAACGCGATACAGCAGAGGTGACTCGGTGGCTACTGAACAGG
AACCCTAAATTACAACCAACGATCGAAGGAAGCAACAATATGCAGCGGAAACTGATGATTTCGATTGAAATTGTTGCAGTATTTAACCCACAAACAACGG
ATCCTGTTTTTGTGGAATATGAGCTCAAGCTACCCGGCCGTTCAGGACACTCTCAGTGGAAATTACAGCCTGGAAATTGTATTCAAAGACGTGGTAAAAC
CCCAATGTCGCTACCTCAGCGATCAGCGTATCTCGGATACCTGTCAACTGCTGCCTTTGGATACCATCAGCACTTCAATCTAACACTCGATCCACCTCAA
GTAGCAGAAGTTGATACAGATGGGGATGTCAATAGTCTGGTTTTCTCTCCAGTCTTCCATCTGAATGTGTATTCTCGAGATTCCTGGCGGCGGAAGAGAT
CAGAAGGCTATGGAGAGATAACACTAAGAGGATCTTCCGATTTTTACGACTTTGATGTGCCTATCCGCAAGCCGATGACCTCCATTCGCAATcagatgga
ggagctcttTCTGGGAATTGAtgaaagtgatgaagacgtcgttgAGGATCGAGCGCGAGAGTGTCAAGTTAACTCGGACGAATCCCCTCTCTCCACATTG
ATCACCAGTCGACTTGGCCAGAAATCTGAATCAACAGACACAATGGTACGAATTCGCTTCAATACCGTCGATCTACAGCCTTCAAAGCGTAGTACAGGAG
CTAATACTACACGGGTGACTCGAAGACTCACTGCTACACCTTTCGTCAAAACGCGCGTGGTAAAGCGAAGCGTACAGGAAATACTGCAATCCGTTAAACT
GGAGAAACGACTAGCTAGTATAACAGACCCCCGCGTTCAGGCAGCACTACGCTCGATGCCTCCGACTGGAGCAGGAACGGAATCGATTAAACATGATCTA
GTTTAGAAGTGTGTCGCGATGTACTTCTGAAGTAACATACACTTTCAGTCATCATCGCtgtccaggtcgtccagTGGATTACCactgcgcttcttcatga
caCGGAAGAACTCCTCTTCGTTAATGAGACCGTCTCCGTCACGGTCAGCTTCATCGATCATTTCCTGcatctcttcgtccgtcAGCGTTTCGCCGAGCTC
CGTACAGACGCGTTTCAAGTTCCGAAAGGAGATTTTGCCCGTGTTGTCGTCGTcaaagagctggaagatctTCATGATCTCCTCGCGCGAGTCCCGAGAG
TTCATCTTGCCCGTCATCATCTCGACGAACTCGTCCAAATTGATCGTACCGGActcgtccttgtcgatgTCTGCGATCATTTGGCGGATTTCAGCTTTCT
TCACCTGGAAGCCGAGCGCACGCATCGCAGCCTTCAGCTCACGCACGTCGATGCTACCGCTGCCGTCCGTGTCGAAGAGGTGGAACGcctccttgatctc
ctccaggtcctcttcatccagcaccttcttcactggCTTGGGCTTGCGTCGCAGCGCTGCACGGGACCGCGCAAAAGCCGAAGCGGACATAGCACTGGAC
TGTGAAGCACAAGACGTTAATAAGCGTGTACACAACCAGATCTACACACAAGACGTACCATATTCAGCGTTTATCCAACTAAGCAGAAGGCGAAATGTCC
GTTAACGACCTTTCATGGCACACTTCAACCATTTAGGATTTAGACCAATATTATAAACATCAAAATTATTTGAGATTTAGATCAGCACTTAAACTTCTAA
ATTCTGACGATCGCGTTCTATTTTTAAGGTTTTGTGACGCCATCAACTTCATCCTGGCAGTCGCACTCTTCAATTGaccagcaagagcttcacTTCCACC
CACAGCGCACAGTCTCACCCCCACCATGTTAGCCGCCGCCGCGAAGCGCATGCAACAGAGCGCAGTACACACGCTCAAGGCCTACGACAAGAGCGAGCAC
CGCGTGCTGGTCATCGGCGGCAACGGCTTCGTTGGCAGCAACATCCTGCAGCGCGCTGTGCAGAAAGGCATCGAAGTGCGCAGCCTCAACCCGTCGGGCA
AGCCGCAGTGGCAGGACGTACCCTGGATCGATCAGGTGGACTGGCACGAGGGGGACGTGTTCGACGACAAGCAGCTGGCCAAGGCTGTTGAGGGCGTCAC
GGGTGTCAGTACGTTCGGAAGAGCTACGGGATCATGAACGTGTACTGATTTTTTAGTGTTTATGACTGCAGTCTCAACGGTGGGAGCTTTTGGCAATAAT
GAGTTAATGGAGAAACTCTGCGGGGATGCGACTATTGCTGCCGCTAGAGCTGCGCAGAAGGCGGGTGCAGAGCGCTTCGTGTTCGTCTCGAACTCGCGAG
TCGGCTCGTACTTCCCGTCGTGGTTGCCTATGTACGGTTACTACCATGGGAAGGAgagagctgaagctgctgtgcaGGCGAGGTGAGAGTTTTAAAAGAT
AAAAAGATACTGAGGATTGTTCTAAAGCTGATTGGTATTGTCACAATACCACAATACTATTGTGTATTAGGTTCCCTGAAACTGGCGTGTCATTGCGCCC
GGGCTTCATCTATGGCTGGCGCCGCACCAAGAAGGGCCAAGGCATCCCGCTGCAACTTGTCGGGGCTCCGATCTCGATGTTAGCACGTGATCTGGGAGCG
GTTTCGACTGCGCTGGGCTACTTGCCATTTGCTGGGGAGGAAATGCGAGCAGCGATTCCAGTCGGTGCAGTCGCCAAGGCTGCGGTACTCAGTGCCATTG
GTCCGGTCCATGGACAGTCGCTGGACACGACCAGCAtgctggaacttgctgcttcCTTCCATATTCACGAGGACTGAGCTCTTTAACTAAAGAGAATTTC
GAAACAAAAGTGACATCTTCAAGGACAGCCAGGAAATGATAAAACTAAAACATAATTATGATTGAAGAAGTCAAAAGATTGATTTACTGCAGCTGAATGA
GAGCTTCTATCGTCTATCGTCTCGCCATTGCTTGAGCGGTGTACTTCATGCCTATAACGCCAATTTTTTTCTTGcgttcttcagcgtcaagtcgccgctt
ctccagctcctccgttCGGTCTTTCCAATAATGCTGTCAACCCAGAAAAAGTTTTAGTCAAGGATGGCTACACAACATCCAAACATACACTATACTACCT
CCTTTTGCTTCTCTTGCTGTTTTTCCAACTCCTCCTTCAAACTTTTAGCGTCTGCCTCACTTTGCTCTGCTTGGCCAGGAAGACACAGCTCTTCTAAGGT
CTGCACCCAGATATCTCGGACACTTGTTGCTCCTGCAGTCAGCTCAAGTAGCTTTTGGCCACTCTGTCCAAGAAGCACCAAGTCTAGACGACCTGAACAA
ACCCGAAGTTGTTACACTTTAAAATTCATTCTAACCAACACGATGAAGTTGTCGTACCCATCGGACAAACTTTGCCGATCCGGTGAATCGGAAGTTCCTC
AGCGCTACTTGGACCGGGTGTCTGTCGCCACATCAGTCTGCCACCAGCACGACTACTCAGTCTAATATTttgtgtaccggtattgtgTATTTCCTAACAA
CAATTATGAATTTCACCTTGTAGCTGCAGGGTTCAGCTGTAAGTAAACGTTCTCCGTCCTACTGAGCACGCCCAGAaacgcgctcttcttcttgaagtca
TTGCCTTCTTTGAGCAACTCCTGCCGCGCCAACATCTCCGAATTCCCACCGCTGCAGCACACATTGCCCATGTTTCGACTGGTGTGCTGTACTTTtccaa
caaaaacaaaaactaCACTCGACTACCAGAATAGGATGTTTGAACTATTTTGACAACTGAAAAAGTACGACAAACGTGTATTTCTCAAGGTTTTGGTGGA
GGGAGAACAACTAACGGGCCCAGCTTTGTTTGCAGAACTTGAAGGAAAGCTGGCGACGACAAGCAAGTGACGACTTGTCCGCTTAGCGGCGCAGAGTCCT
CTTGGCAGCGCAACCACCACCCGAAGTCGGGGTCGTGCTGGAACCCCAAGGAGAGCCCTTAgtagcgtctccagctccactcgTGGATCCGCCCGTGGTC
GTACCCTTGgtagcgtctccagctccactaTCAGAGCTCGTGGTTGTGTCCGAGGAGCCGCCCTTGGTAGCGTCAGTTGCTCCACTGTCGGAGCTTTCGG
TCGTGCTAGAGGTTCCTCCCTTGGTAGCCTCAGCTgctccactgctggagctttcggtCGTGCTAGAGGTGCCGCCCTTAGTTGCATCGGCGGCTCCaga
cgcaccagcagctgaagaagttccgCTCGAGCCTCCCTTCGAAGCGCACGTGGTGGCCTTAGTCGGTGAAGTCGTGAAAGCCGTCACCGTGAAGTCGGGC
TTGCCGCCCTTCttccacgtgcagcacggGTCGCCAAAGGCGGCGCCATTGGTCATGCTCGAGCCTGGGAACTTGGCCTCGCACAGGCTCTTGGCCCACG
TGTGGCCAGCAGTGGCGAACGCTTGGGCAAagtccgtcgtcttcgaacTGTCGTCACCTGGGTGGCCAAGACCCtgctggaaggagctgccattcggaag
ctcgtggaggtACTTGGCGAGACCATAAGTCGAGTCAATTGTGGCAGCGAATGCCAAAGCAGCGGAGGCGATTGCAACTTGAATCTGCATTCTTGTGGTC
TTGCGTTGGTTCTGGGGGTGGTTTTGGTGGTGCGAGGCAACTTGGAAAGTGAGAAAGGTATCCGTGGTCGGCCTCGAAAAGCAACACGTCGGGCATTTTT
CGGATAAAATTGAATCGAGGATCGGGCGTTCTGGAGGTGCTGTTTTCCGTATCTG