Description :
From Genome Similarity Track
Location :
Scaffold_353:8512- 10446
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_353-snap-gene-0.15Heat shock protein 70
Pytul_var.sporangiiferummaker-pug3_contig_353-snap-gene-0.16Luminal binding protein BiP
Pytul_var.sporangiiferummaker-pug3_contig_353-snap-gene-0.9Tyrosine protein kinase

Sequence
1934 bases(100 bases per row)
TTGTTGCGTTCGTCCTGGTCCTTGTAGCGCTCGGCATCCNNNNNNNNNNCGCCGGCCGCAGCGTACATCTTCTGCAAGATTGGGTTCGCAACGCCTTCCA
ACTCCTTCTGCTTGGCCTCGAACTCTTCCTTCTCCGCCGACTGGTTCGCGTCCAACCAGTTGATGGTCTCGGTGACCTTGTCGTTGATGGCGCTGCGGTC
CTCTTCCGAGATCTGGCTCTTCAACTTCTCGTCATCCAACGTGTTGCGCAAGTTGTACGCGTAGTTCTCGAGGCCGTTCTTGGCTTCAATACGAACCTTG
TTCGACTCGTCTTCAGCCTTGTACTTCTCGGCTTCGGCAACCATGCGGTCGATATCGGCCTGCGACAAACGACCCTTGTCGTTCGTGATCGTGATCTTGT
TCTCCTTACCGGTCGACTTCTCGACGGCAGACACGTTCAAGATACCGTTCGCGTCAATGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCATCGGCGGGATACCGTCAAGGTTGAACTTGCCGAGCAAATGGTTGTCGCGCGTCATCGAACGCTCACCTTCGAACACCTGGATCAACACACCTGGCT
GGTTGTCGGCGTAGGTCGAGAACGTCTGCGATTTCTTCGTTGGCACCGTCGTGTTACGCGGAATCAGCGTCGTCATGACGCCGCCGGCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCGAGGAGCAACAAGTCCTGGAGCTTCTCCGACTGGTCGTTACCCGACAAGATAGCGGCCTGCACG
GTGGCACCGAACGCAACAGCCTCGTCAGGGTTGATCGACTTGCATGGCTCCTTGCCGTTGAAGAAGTCCGACAGCAACTGCTGCACCTTCGGGATGCGCG
TCGAGCCGCCGACGAGCACGACCTCGTGCACCTGGCTCTTCGAGANNNNNNNNNNCAATGGCGCGACGTCCAAGAGCAGCAGGTCCTGCAAGCGACTCGA
CTTGTCCGATCCGCTCAAGATCGCGGCTTGCACCGTGGCGCCAAACGCGNNNNNNNNNNGGCGCACAGATCCTCGAACCGCGCACGCGTGATCGTGCTGT
TGAAATCAATGCCCTCGAACAGCGAGTCGATCTCAATGTACGCCTGGGACGACGACGACAGCGTGCGCTTGGCACGCTCGCACGCTNNNNNNNNNNACCG
CACATGTCCTCGAAACGGGCACGGGTAATGGTCGAGTTGAAATCAACACCATCGAACAGCGAGTCGATTTCAATGTACGCCTGGGCCGACGACGACAACG
TACGCTTAGCACGTTCACAGGCGGTACGGAGACGACGCAGCGCACGCTGGTTCGACGTGATATCCTTGCGGTGCTTGCGCTTGAACTCCTGCACGAAGTG
GTCGACGAGACGGTTGTCGAAATCTTCACCACCCAAGTGAGTGTCACCAGCGGTGGCCTTCACCTCGAAAATACCTTCTTCAATGCTCAGCAGCGACACA
TCGAAGGTACCGCCANNNNNNNNNNGCGCAGGCGACGCAACGCGCGCTGGTTCTTTGCCATGTCCTTGCGGTACTTGCGCTTGAACTCCTGCACGAAGTA
CTCGACCATGCGATTGTCAAAGTCTTCGCCGCCCAAGTGGGTATCGCCGGCCGTGGCCTTGACTTCGAAGATACCTTCTTCGATCGTGAGCAGTGATACA
TCGAACGTGCCGCCGCCAAGGTCAAAGATCAGCACATTGTGCTCGCCGCCCTTCTTGTCCAAACCGTACGCGATCGCGGCCGCAGTCGGTTCGTTAATGA
TGCGCAACACGTTCAAGCCCGAAATGACGCCAGCGTCCTTGGTCGCTTGGCGCTGTGAATCATTGAAATACGCCGGCACCGTGATCACGGCGTTCTTGAC
CTGCTTGCCGATGTACGCCTCGGCGATCTCCTTC