Description :
From Genome Similarity Track
Location :
Scaffold_25:851169- 858487
Sequence
7318 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGCACTCGTAGTCAATCTACGCCAACGCGCGTAGACTACCTGAGCCTCTCTGAAGTTAGTTGCCAAGGATAGGAACGAC
TTCTCCCATCTGAACGACTCACAGTTCGAGTCGGTTCGGAAGATGGCTGGCATCGATGGGATGGAGGCCCTGCAGAGCCTGGTGGCGTCTACACCGGCCG
AGCAGCTCGAGGGCGTCAGTGCGTTTGATGCTTACGAGCAGGGGCTCATCGCACATGTGCGAGAGAACCTGCAGGCTCCGGCGGCGGAGACAAATCCGCC
ACGCCCGAAGCCAATGCGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGTGAGAACCTTCACTTCTGGGTCCGAGAGGTAGCGCTCGCGATGGACGCG
GCTCTGATCTCGACAGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACACGTAGTGAGAGGCAACATCCC
CTGGATATTTCGCATCCTGGGCTCAGCTGTGCGAGCAGCTCCAAGTCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCGCTCGCGCTTCCTCTCGTG
CAAACAAGGGAGGCGTGAGCTGCACGAGTACGTCCAAGAGATACGGGAGCTCACGGCGTTCCTAGTGGGAAACCCACTCAATGAACACGTCAAGATGACT
GTGTTCATGGGCGGCCTTCGAGTGAGCCCAGCGCGTACTCAGCTGTTCCGGGTGCAGTCAAGCATCCTTGGAGATGCGATTCAAGTGGCTCTTCAGGAGG
AATACAGTCATCGCCAGGCGCGTACGCCGGTCTCAGCATGGTCTGGGAGTTCTTTATCGACTCCCGGTCGAGCGAGCTCCAACGGACCAGTTCCCATGGA
GCTCGGGTCCGCCGAGCAGCGCGACATTCGCTGCTTCGGTTGCGGGAAGATGGGCCACTTCAAGCGCGACTGCCCCGAGGAAAGACTCCGCAGATGGACT
TTCCCCAAGCCCGTCCCCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGGACGCTGGAAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGA
ATTAAGTCTTCGTGAAGGGTGCGCGGGTGGCGCGTACCACGATGACTTAGCCCCTAAGAGTCTTCGCACTCTCGAATCGGCGAGGACAAGCGGCAGGCTG
CTCGTAGTACACGGATGTGTACGGGGATACGATCACCCCTTTAGAACCTTGATAGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTC
GTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGATCGTCCCTGCCCCCAACGT
CCAAGTGGATCTGTTTGTCAAGTTTGAAGACTTTGACAGCCTCAAACAGTTCACTGTTCTTGATATGGATCCATATGATATGATCCTGGGCATGCCCTGG
CTTGGGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCACCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCATCT
CTGTCAGGACCCGGGGTGCCCGCAAGGGTTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTACATGACGACTCCGAGGATGTTTT
GATGGTGGCGGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACAATGGTCCACAAGCGGGTAACATAGCTCCGCAGACAGCTGCAGCTGTCACGAGCGCT
GGTAATAGCGTGTTCAAGGTGGGTAACAGAGTTCCACATACGGTAGCCCAGAACTTAACTGAAGAGGAAGGCGTCTGATACGCTTCTTGTGTGGATAACA
TAGTGTCACACGCGGACGCCCATACCTTAACTGCAGAGGAAGGCGTCGGACACGCTTCCTGTGTGGGTAACACAGTGGCACACGAGGCCTCGAGTGTCTT
GAATGTCGGTGCTCCGACATCCCCAGATGTGGGTTGCAAAGTTCCACGTCACGATCGCCGTCGACGACGACGACGCCGCCGCCGAGAGTCGGATCTGAAC
CTCGTTCAGATCGACGTCGCTTCAAGTGACTCGGAGTCCAGGACCCGGTCTCCTTTGACACGGCCGGTGGACGAGTGTAATCACATCTTCGGTGGCGAGA
CCGATTTACCCGTCAAGGCATCTGGTGTCCGCTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGGGTCTGTCCTGGC
CAACCTCAAGGCTGCGAAGGTTGCCGAGATGGTGCTCATAAGATCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTAGACGAGGACATCCTG
GAAGACCTGAACATGCAGCATCAGACGCGCTTGGGTTCCGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTAGGTGACGGAGTATGCGGATGTGG
TGAACAAGCACCCACCGACCCAACTCCCACCAGATCGAGGTGTACGGCATGAGATCGATGTCGTGCCTGGCACAGAGTACAGTCACGAGAAAATGGCCTC
TTCCGCGCGAGCAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGATGTCAACTTT
CTGCGTTCGGAAGCCGAACGGAAAGTAACGTCTAGCTCATGCTTATAACAAGCTGAACAGCGCGACGGTGCCGGTCCAGACACCGATCCCACGAAAGGAT
GTGTTGTTGAACAACATGGCCGGAAGCGTATTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGCGAGAGCAATATCCCACTCA
CCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCCCGGCTTGTCTAATACCCCGACGACGTTTAACCACCTCGCGACGCAATT
GTTCAGGCCACTGCGCGCCTTCGTACAGACGTACTTCGACGACATCTTCGTTCATAGCGGTGCCGAAGGAGGGAAGACGGCCATGGAGGTGCATCTGGGG
CACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAGCAAGCTCGTCGCTTACATCGACAAGTGCGTCTTCACGTCACCAGAAATTAAGGCTCTCAATTGCT
TCGTAACGTGGGCGTTCGGGCTGACCCCGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCTCCGATCCCAGAAGGATCTCCGAAAGTGGTTGGGCTTG
ACCAACTACCTTCACAAGCACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGGCCTCCCCCAGAAGGACGCCGACTGGCGCTGAGAGCAAGAAC
GCCAGGATGCCTTAGACAACATCAAGGCCAGTCTCCAAGAAGCCCCTTCTCTGGCCCTGACGGACACGACGACGCCGATTTGCGTCGTCCGCGACGACTC
CGGCTATGCCATCGGTTGTGCACTACTACAGGCCGACACGGCTGGACATGAACGAGTCATCTCTTTCCAGTCCAGGCAGATCAAAGCCGCCGAACAGAAC
TACCCTATCCACGACAAGGAGCTCCTGGAAATGAAGTATGCCCTTGTGAAGTTTCGAGTTCACCTTGTGGGCGCACGGTCCTTTGTGATCTACACAGACC
ACGCATCCTTGAGGACGGCGACAAATTCGCCGCACCTCTCCCAACGGATGGCGATGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTCGAGTACAA
GCCTGGCAAGCTCAACGTACTTGCGGACGCCCTCTCTCGGCGTCCAGACAACGAGTTGGCCCACATCACACGGGTGACAACGGATCAATATGATCGGATA
CGCATAGCGTATCGGGACGATGAGGCTCTCGCGCCTATCGTCCAGTTCCTCGCAGCAGGAGCGAGCGCGCATTCCGACTGGCTTTTGTCGCGACAGCGCT
CCCAGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATGTCCGGGTGGAGCCCAATGAGCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAA
GCTCGACATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCAGCCACTGGGGTCACGAGAAGACCTTCCTGTCGGTCTCTCAGGCCTTCTGGTGGACCAAC
ATGCTCAAGTGGGTCGCACGATACGTGAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTTC
CGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGACTTCTCGCCGACGGACACCGCAACACCGGGATTTTGGTGTTCGTGTGTCGGCTGAG
CAAGATGGTACATTTTGCTCCCGCTCCCGCTACGGGCGAACAAGCCGCGAGGTTGTTCATCGATGGCGTGTTACGCTATCACGGTCTCCCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCACGCGCCCACGGGGCTCACGTCGTTCTACCCGAATTGCTTACGTCACCCCAGGGTGCCTCTCACTCTTCGAGGAGACACTGCAT
CCTCTATTTTAAGTGAGAGGGGGGGGCTCGGAAAGCTCTTTCCCCGCAGGTCTCGGATGTGAGACCGGTTTCACTGTGGAAACAAGTGGAATTCTTTGTG
GATACCAAGCTGAGCGCTCTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGACAGACAAAAGGAGTACTCTGACAAACATGGAAGAGGAAACTTAA
GTGCATTTAAGGTGGGGGACTTAGTGCTATTAGACACGAGGAACCTACCGCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCATCGCTTCAT
CGGACCATTCGCAGTCCTGGCCAGGCATGGTGCGTCGTACACCATCGATCTGCCTAAGTCAATGGCGACGCACCCGACGTCCTACGTTGGACGTCTTAAG
CGGTACTATGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTGGCCGGACTCCTCGAAGCGAGGGCCGGCCACAGACGTCGACGAGGGCGTCGGTGC
AGGCACCCAAGCCTCGGTTTGAACGGCAAGGCTGCGATCAAGACCATACGCAGGAGGGCCCCCGTACGAACGGACCCCGGAGCCGTACACCGAGTACGTC
GAGTACATCGGGTACGCACCATACGCGTACGCCTGAGCGTGCGCTGAATGCGACTCCGGACGTGGCAGCAGAGCCTCGTCCAGCTCGGACGAAGAGGGCC
GCCGGTCCACCCGCAGATGAAGGCTCGAGACCTCACGCTCCAACAGGTCCAGGTGGTCCGCAAGACGAGCGAGCTCACCCTGATTCCCGGCCTGGGCGGC
AGCATCCCCGCCAGTCCCAAGGCCAAGTGCAATCCCAAGCACGAGGACACGGTGACGAAGGCGATCAACCAAAGGGCCCTGCGTCGGACCCGCAGGAGAA
GAACTCGGACGAGAGTAGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCTGCCCCTGCTTGACCGGAGCGGAGAAGTCCACTATTAC
GTGGAGCTTATTCTCCAGAAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGAAGCCGATTG
AACGGCTCCTGATTGACTGCCCGAAAGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGAGGCTTCTTGCCCGAACGGGGTACG
GACGTTGACGACACTCCGTACCCGCGCTTATCGTGAGCGCTAGAAGCCGCGTGCTTCAGAATGTCCCTTGGCAGCATGCGCTTTCTGACCAAGTGGACAA
ACCGAACACGGAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGTAGTTCCCGCAACTCCGAGGGTGAGTACTTGAGAGACTCCACCCA
AGCCCAGAAGATGTCCTCACATGAGTTCCAGTTGGGACAGTCCTCAGGAAGAACCCATATATAGCGCCGGATATGGTAGAGATCACACCGGCTCTCGGGC
TTCTTATGACAAGTCGTGAAGTCCTTTAGAGGGATATGGGGAGGCGCGAGAAGCACACATCGAGCCGCCTCCAAGTTGTCGACAAACAACTGCTCCTTCT
GGACCAGGGTACGTTCGCAAACGCCCCTAGAGGTGTGGCCGCCAACAAGGCCACGAGAAGCGACAAGAACCTACAGGAAGAGGTCAGCCCCAGAGCTCTC
CGCGGAAGGTCAGTACTCTCCTGAGTTGATGACAGCCTCCTGCCACCACCAAACCCCCACGCGCACGCTGGGCAGCTTGGAAGTCCTCCTGCTGCTGGTC
GAGGTCGTTAGTGATCTCCCGGGGCTCAGGAATAGCACCCTCTTCCTCCTCCTCTTCGTCCTCTATATCCGAGGAACCGAAGAGGTTCCGATTGGAGTAC
CCAGTCTCCTTCTCCTCGCGGAGTGGAGACTCCGAAGCCGTACGATTCTTAGAGGGCTTGACGCATTCGGCTTTAGCGGTCTTAGCACGTGCTCGGCCCT
CGGCAAGCGAGAGACGTTTGCGAAGTTTCTCCTCCTCGTCGTCGCCAGCTTTGGGGGCGCCCTTAGCCTTGACGGTCGGGCTCTCAGAGCGCACAGACGT
CTTGGGACTGTGATCACCGTGATCACTAGCGAGCGAGTGTACGCTGTCGTCCTTGTGCTCGCTGGGCACTGAGCTGTGCTCTCCCACGGAGCCCACAGGA
GCATCGTGCATGCTCTCAGACTCGGCTTCGTCCTCACTACCCGAGCCGAACTCACGTTCAGCGAACGGAGGGTTCGGATGGGTGTCTGGGGAGGTCGAGG
GTGACGGACTGCGGCGCTTGCTCGCACGCTTGCCCACAGCCGCGTCACCAGATGAGCCGATCGCCTCGGAGGCCACCTTAGTAGCCTCCTAGAGTGTTGA
GCCTTTGCCGTGAGGCTT