Description :
From Genome Similarity Track
Location :
Scaffold_5:851158- 876054
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04587hypothetical protein
Phypa_INRA-310PPTG_04588hypothetical protein
Phypa_INRA-310PPTG_04589hypothetical protein
Phypa_INRA-310PPTG_04590hypothetical protein
Phypa_INRA-310PPTG_04591hypothetical protein
Phypa_INRA-310PPTG_04592aspartyl protease family A01A
Phypa_INRA-310PPTG_04593hypothetical protein
Phypa_INRA-310PPTG_04594hypothetical protein

Sequence
24896 bases(100 bases per row)
TGATGCAACACTGCAGTCGTGTCCGCGACGTTCTCGGGCGTCACCGTCACGCCACCAGTTGAAATCGTGCTGAGCGCTTCCAGTGCGGCGGTGATACTAC
CGAACGAGCTGCTGGTAGTCAATGAAGTTGTAGCCGGCGAGCCGCGGAAGCTCAGCGTGAACGGTGAGGCATCCACACGAACGCGCTGTACTTCTTGAAC
TGGCGCTAGCACTACCGCGCGCAATCGGATGGCCTGTTCTTCGAGTCGACGAGTATCTTTGAGTTGCACCTGGAAAGACAGCGGCTTGCCTGCTTCGATC
ACCATTTGCTGCGCTTCTACGCTGTAGTTCTCCGTCCGCCAATCTCCTGTCGCTGCTAGAGCACTCGGGCCGTGGGTAGTGTCGTCAGTCACTTGGACTG
TAAACGGGCTGCCCTTCACGTGGGTATCTCGGTCCCAAGTCGTTACGGCCACCGTGTACGAGCCGGCGTAGTGCGGCGTATACCACACGGGGTAGCCTCC
TGCTGCTGCCGTGTACGCCACCACGAGAGGATTCGCGTACAGGCTGGACGCGAATTCGTTCGTGTATTCCACTGCAAGATGAGCCTCGCTCCATTGCAGC
AGATGCGAAAGGAACGTCACTCTCCATTGGTATCCACTCCCGACATTCGTACGTGTGACTGCCACCTCAACATTAACGTGAAGGTCCTGGAGAATGGATC
GTAAGCCTGAAGCACTTACATCGTGGGGAATTAACGGCGTCAGTGCTTCCGTTGCTGCTGTACTGGACGCTGCGACCTGGAGAGCGAACTTTTGCGAAGC
GAAGGCTATGCAGCCGTGGTTGGTAACAACAGTCACACTGGTAGACGTCACACTTGCGGCCGTGAAGATACACTCCTGCACTACAAACTTGGTTCCATGA
AGCAGAATCCCGACCAAGTTGGAGCTCACGGACAGCACGTCGCCTACCAAGGCGGTGACACATAGAGGACATAACTGTTTCCGGAACTTTCCGAATGAGA
GTTTGAAATACCCGGCGATCGTTTTGTCGGCGCTCGTAAGCGTTTGCACTGCGGTAGACGTACGAAACACTTCATCTTTACCCGTAAACGTGACCAGGAA
GGCGTCGGATCTGCCGTCGCCAGTGGTGAGCGAATGCGTCGTGCGATCACCTTTCCGTAAGTTCCCGAAGGTGTCGCGCGCGTAGATTGTGAAGGTTGTT
TGATGGCCACTGGTAGCTGTACTCAGCGCCCCGGTCGATGTATCGTCCACGGTGCAGCTCGGACCGTGTAAAAAGCTGTGTACTACCGTGAGTATTGCGG
GTGTGTTCAACGCCAGGCATGTCACGCCTCCAGGACACATGAGAATTGGGATCCCGTTCAAATACGTCTGAATCTCGTACGTTCCAGCGCAAGGAATCGA
GTACTCGACGGCATAACGACCCGTTTGTCCGGCGACGAGGACGTTGCTGCGGTACTGTACCGATCTATCAGTTTGAAGAACCATCTTGGTCTCGAACACG
TCATCGGCGTCTGCAGCGTTGGCGTACGTGTCGCGGGCTTGGATCGTGAAGTTCGAAACCAGTCCAGCCACAGCTTCAATGAGACCATCGAGAACGCCAT
ACGTCGAAGCGGCAGCGTTCCCTAGCGCTTGACTGGTATGCGGCGTCGCCGGACCAGGTCGAGCGATCAGTGCGAACGGGCTGCACTTGTGAAGCTTGCC
CAGTCCGCAGTAGATGTCGATGCCGTTCACTGTCCGTACCGAAACCGTGTACGTTCCGCTGACGGACGGCAAGTACCGGACCAAATATTGTCCTTGACCG
ATGTATTTGGGCTCTTCGAACGGAGCGAGCTGCACTCCCGTCGCCGTACCCGTGTTTGTTCCCTTGATCTCCACGTCAAACGCGTCTCCATCGACAGTTT
TGTTGTTGTCGTTCTGGTCCTTGGCTTGGATAATAAACTGCGCTGTCACCCCCGCTGTGGCGATAGTAAGACCGTCACCAAACGCTGTCGTGTACGGGAA
GTCTGTTGCGCCAGGCGTGACTATGATCGGGTACGGACTACCAGCGATGTGTTCGCCGTGGAACAAAGCACTACTGGGGATCGGCGCGATGGGAAGATAC
GATGAACTCCACGACAATTTAAAAGAAGCAGCGCCTGAAGCTTCATGGTACTCGATGCGCAGATCGTAGAACGTTCCTGTCTTTAAAGATTCACTGAAGT
TTTCCAGCGTTCCTCCTTCATCTTCGCCGTCTTCCCACGTATCAACACGAAGCTGGTGGTTCAGCCACACACGTACGCCTTCACTAGACGATACGTAGAA
CACATAGATATCCGCCGTGGGGACTGCGAGTTTACCGAACCATCGGATGCTAATGTAGTCTCGTCCGTAGTTAGAGACAGCACCTTGACCCCAGTCGAAG
CTTAATTGAGGGTCTACACGGACGATCACAGGCTCGTCTTGCATCCAAAAGTTGTCAAAGTAAAGCGCCAACAATCCACCCGAGAGAAGCTGCTGTACTG
AGACCGAGTAGTTGTCTGCTGCCTCGTACGGAATGTATCTCGCCGTGTAACTGGGCAACCCGCTCTGTTTCTTAAAGACAGCAAGTTGAGGGAATTGTCC
GGTCAACGACTGCTTTGTTCCAGGCTGAAGTTCAGTCACGCTCACGTCGGGGAAGCTGCCAGTGAGACCCGAAGCATCAGCAACGAGAATCCCGATGTCA
CCCAGTCTAGAACGGAACGTCACTTGCCAGCTGAACCGGTTCCCTGCGTCCAGTTTGTCCGTTCGAGTGACGCCGACTAACCCCACCGAAGGCAGTGCCT
GGAGAGCGAGCTTCATGGCCACGTCACTAGCATCGTACGCGATAGGAGCCGTAATCTCCGTTAAGAAGGAAAGCTTGAAGGTGCCTTCCAACGGTGTCGG
AGAACCTCCCAGCGTTGTGATTTCCTGGACTTCGTACGCATAGGGATACGCTTCAAGTAGTGGTAAATCTCCCAAGTTCTTGGTGAAGGAAATCGTCCAG
CGGTTGCCATTGTAGCGTTCCTCCTTCCTGACGTCCACTTCTTGGACGTTGCTCAGTGCCGTCTCCAGTTCCATCTTCAAGTCTACAGCCTCGATGTCAA
ACGGCAGGTTGTGCGTCGTCCCGCCCATGAAATTCAGCACAAACGTGCCTCCCAATGACAAACCCATCCGCTTCACCTCCTTGATAAGAACTGTAGCGGA
ACTGCCCGTCAACGAAGTCGGTAAGTCGAGTTTAATGTCTGGAACTTTGCCCATAATCTCGTTAAACGTCACGATCCACGTCTGCAGTCCTGTAGTCGCC
GTGGGCGTCCCGTAGTTGGCGCTCTTCACCGTCACAGACACGTCGTCGATCCCGTTGAGAGATTCGAGTAGGTTCTTCATTGTCGGGGCATCGGCATTGT
ACGGAACTGTAATACTACCCATACCGGTAAATGTAAGAGAGAAGGACCCGCCCAACGCCGTTGTTGACCCGGTTACATCTAGCCACGTCGAAATGGACTG
CACCTCGGCTGTGGATTCCACGCTAGCCGACGTCGTCACCGTCTGCACGTCACACACTCCCTTCTGGAACTCTGTGAACAGCACAGGTGTTGTAGTAAGG
AGAGTCGCGGAAGCCATGAAGGTGGCGTCTCCAACCAGCTGCAGAGGCGGCTGGTCGCACAAGTCGGTAACGAAAGTGACGGAATATGTCCATGGAGCGG
CCCCAGCCGTGGATACGCGGGAGACCAGCACACTTTCAACATTAGTGAGCGTCTCCAAGTTGGTCTTAATCAGATCAGCGGCCTTGGCGTCGCTCGCCGC
AGCCAACACGGCGGCGTCCACCGGCGCAGTGTTCGTAGACACTACGCCACCCGCGCGAGCGCCGGTTGTGTCTAGTTTCAGACGAAACGTGCCCGTCACG
CCGTTAAATCGCAGCGTCTGGATCTCGTACACCACTGGGTTGTACACGGCCAAGCCTCCTTCAGACACGAATGCATGGGTACCGTCGATGACCGACGGAG
GCGAGGCCCACAGCTCCGTCCAGAAGCGATCTTTGCCTTGAAAATTGGCAGGAAGCGTAGCGTACGTCACCACGTCGCCCGACGCTTTTCGAGGAGCGAT
AGTGAACTCGTTCGCCTCGCCCTTGACGAACTCGTCGATCTGAACATGCGTCGTATCGCTCGATACGAGCATGGGGACGTCACCGACGACAGACACGAAG
GTGACGTACCACACACAGTCCGCGCCGTTGAGATCTGCGCGAGAAACGTGCACTGCGCCAAGACTGGAGATGGTCGTAGGCAGCATCGCTTCCAGAGCGC
TCGCAGTCGTTGTTGTGTCGATCGCACTGGTCGGACTGGACGTGCCCCACCGCAGCGTGAACGATCCAGTCAGTCCGTTGGTTTTCACGCTCTGCACCTC
GTATACAATGCCTGCCATTCCTTGCAACAGCGCCGGCCCGTATGCTTCAGTATAGCTACTAGCGGCGCCAGGCGACGCTGCGACAGCAGGCGTGGACACA
CCGCCAATCCCGTCTCCAGCAGCGTTGATAGCCACGACAACGAAGGCGTACAGCGTATCGGACACCAAGTTGGTCGACGTGAAGGACAGAATATCGGGCG
AAGTCGCACCGTCGTACACCACTCGACCGGGCGTTCCTTCCTGTGTTGTGGTGACCTGAGCATTCGGATTGCCACCAGTTAGTCTGCCTGTCGTCACCTT
CATCAGCGGCAAGTCACCGAGCTCCGTCAAGAACGTCACGTCCCAGATCATCGCGTTGTTAGAGCCTGCCGTTGTAGTGACGTCCACGACACCGATGGAC
GGGAGGTTCTCCAGCTGCCGCTTCATCTCAGCTGCATCCGTCGTAGTCACGGACAAGTGACCCGTTTCAAAGCCGTGGAACGACACCGTGAAGTCGCCTC
CGAGTGCTGTAGATCCTGCTTGCACTCGCGTCACGGACGTCGTGTACGCGACTGCAAGCACCGTGTTGGTGAGTTGGTCCGGGACAACCACCATCAAAGC
TTGAGAACCGTCCGCCAATGCGAACGTGATCGTCCACGTTCGTCCTGTAGCAGTGGACGTGTGCGTCACACTGGTCGGGTTAACCCCGCACGTGGCCACG
GCGGTCTGTACTTCGAGATCGGTTGCACTAGCTGATAACAAAGGTGTCGGCTGAGAATTCACGTACAGTTTGAACTTGCCGGACGCTCCTATGACGGACA
CGCTCTGAATCTCTGGCACCGGGGCACTGACTGTCGTCCGGATGCGTTGAATCTCCACATTGACCGGGGAACCAGACGCCGTAAAGCTTGCAGTCACGCC
TGCAAACTGCCACAATCTGTAGCCGAGCAGTGGAGAACCATTGCAGCCTGTGAGTGTTGATGTACAGGTGGAAGGAGGCTGCCACGCCACACTAATCGCT
GTCGCCGACACATCCGTGATACTTGGCGCACTTGGAGCGGACGGCACGTTTGCTAGCACCAGAGCCAGCACGGGGCTCTTTCCCGATGGTCCAACAGAAT
TCACGGCCAGGATGTAGAAGCGGAGGACTTTGCCCTCCGTTCGGCCTGTCACCTTGTGCGAGTATCCGTGAGGAAAACTACCTATCAGTGTCTGCTGGGC
CCAGCCGGTCCCGTCGTCCATAAACAACTTGTAGCTGGTCACGGGGGATCCGCCATTGTCCTTTGGTGGCGTCCAGTTGATGAAGGCGATGCCGTCGTTC
GCTGCGTTCGTGTTGATTGTGGTACGAGAGTCTCGCGTCAACGACGCCGGCGGGTCAGGAACGACAGGAGATCGGACCGTGTACTCGACCGGATCACTGA
AGGCTCCGTAACACGCGGCGTTGGTATTCTCCGACGAGCAAAAGTTGACTGCTCGCACCTTGAAGGAATACTTGTGACCGGATTCAATCACGTTATCCGC
CGTCGTCTGCAGAGTCGTTTGCAGCGTCACGGCGTCGTTTGGACGGTCATAAACTTTCCTGTACGACGACTCCGCCCACTCCGAGATCCAGAGCTCATAG
CCGCTCACTGTGGCGCCACCATTTACGGTCGGCGTCTCCCAAACTACAGTAATAGACGTCGCCGTCGAGGACACGAGAGTCACAGGCCAAGGCGCACCTG
GCGGTAGGTTCCTCGTTGTGACAAACTCCGGTACAGGCAGCGCTCGATATCCAAAACTCACACTGTTGTGCCAGTAGACGCGCGCGTAGTACTTGGTGCC
ATACGTGAGGCTCGAAATGACCGTTTGGAACGGGTCTCCTCCTGATAAATCAGTCACGAGCAGCATCGTAGTGGGGGCTACTCCCTTCACGGTCTCCGTC
ACCACCACTGTGGGGACTGCCGGGGACAATCCACCGATTAAATTCGTAGTAGCTTTATCGAGTAGAGTCACGTCCCCGATGTTGCACACGGCCGGGTTGA
GTCTACATCCATTGAAGGTTATAAACCACGAGTAACCGTCTGAATTGGTCTGACGCGAGACACTCACGCCGCCGATTGAGGATAGTGTTTCCAACGCTCG
TTGTATCCCTTCTCCGGTGTCATACGGCGATAGGTTGGCAGTGGTTTGGGTGACCCCACCGACAGTGTACGAGAGCTGGAAAGTGCCATCAAGTGGCAAG
GATCCTTGCTGAGCCACGACCACTGCGGCTTGGCTATTCGTTCCTCTTAGTAAAGTCGAATCGGCCACCAGCGTGTCGATGTTGCCCGCTCCAATAGGGA
AACTGCCTGGGTTTGCAGTGAACGTGACAGTCCACGAATACTCGCTCTTTAGTGACGGTGCCGACCGCGTCACGGACACAGTGCCGACGTTCGGTAGTGC
TTCTAGTTTGCTCTTGACGGTCGTATCGGACGAGTCGTGACTGATTCGCTCCGTCGTATGGCCACCCAGCTTTAATTTAAAGTATCCAGACACGCGATTG
CCGCCTACGGAGACTGGGACGGCTGGGTCCGGCGTCGCGCCTCGAGAGTACACTGTTATCCCAGCACCGTTACCCTGGAGAAGGTTGTTCGCCGGTCGAA
CCAGCATGTCCGGCACATATCCGCTGTTCTGGAACGTCACGCGCCACAAGCGCTCGCCCTTGGCCACATTCGCGGCCGGTAACGTATTCGTTCCATCCGT
CACCAGGATCGTCATGGACGAATCCAAAGCTGCTAATGCTGCTTGGACAGTAGCGGCCGGCGCGTTATACTGGAGAGTTACTGTGTCAGCGTCCTTGCCT
CTCAGATACGTGAGCTTGAACGACCCGCTCACAGGAGCCTGGCCTTTAGTTGACTCGGTGATGTCGACGCGGCGATTCCCTTCCAAGTCGTACGTGTTGG
CGGTGAGGAGAGGCATGTCGCCTTGATAGCTTATGACGGAGGTGAACGTGACCTTGAACCCAGAAGTACAGCCCGTGATAGGACAGGGGCGACATGCTGT
TGTCTGTCCACCGTAAAACGCCACAGTCACCGTCGTGATCGCGTTCAGTTCCTCCAGTATGGCTTTGATCTTGAGAACATCGGTTTGACTCGCCTGTATC
GGCGCGGTCGTCTCGCCCGCGAAGGTGAGAGAAAACGTTCCTGTGTTTCTATCTGCGTCACAGTTCACCTGTTGGACCTCGCTTGCGGGTGAGCCAGAGT
ACGAGCTGGTTAACCGAACGAGCTGGACTTCCCCCACTGTATCCGTTGTCGTGCTGATCGTTTGCACCTCGTTCGTCACGGGAACAACCAGGCGAATCTG
CTGCACTTCATCCACGATCGGACTTGTGCTATACTCGACACGGTACGAGTCCAGCGACGCTCCCCCATCGTTCTCTGGTGAGCTTAAACGCACCGCCACA
GTCGTGCCGTCAACTGCAGACAGTGAGACGTTCGTCGGAGCACTCGGAACCTGTGCCGTGGGGATAGCATACTGCGGCGTAGAGTAGGTTGGCGGGCCCC
GTCCAGCCGCGTTGATAGCGGACACGCGGAAGTAGAACGGGACGTTCTCGTCGACATGGTACGCTGTCACGGACAAGTCGCTGAGGTCTGTGATTACGAC
GCTATCAAAACTAAGGCCGTTTGTCCGGTCTTTGCTGTTGAAAGGCGGCAGTACACCCTTCGTGGCTTCCGTCACGTCGATTTTCGGTGCCGTTCCTGTA
AGTGCTAGCGCGTCCGGCTGAAGTGGCTGAAGATTCCCGAGATTGTTGAGAAAGGAGATTGTCCAGGCGTAGCCATTGTTCGGATCTGCGTTAGACCTCG
ACACAGCCACACTGCCGATGGTCGAGAGGGTCTCAAGCTGCGTTTGCATCACTGCCGCACTGGCATCGAACGGCATGTAACCCGTACGCTGACCTTCATA
CTCGAGCGCGAAGACGCCACCGAGCACTGCCGATGTGCCGTCCGTACCCGCAGCTACTGTGATTGTATCTCCACTTACAGTTCCTGTAGCACCGTACGAA
ACCCCGTTGTTAGTGGAGACGGTCATCAAGGGCAGGTTCCCTGCGTTGCCGTCGAAGGTCACACTCCATGTGCACGTCTGCTTTGCCCCCGCCGTTGCCG
TCACTGTGACTTGGGCGACGTTAGCTAGACGTTCTAGCTCCGTTTTGATAATGTTTATGGTCCCATCCGTGACTGTACTGAGTGCGATGGTGTCGTCTCC
AATACTGACCGTAGCCGACGCAGCAGCAGCACTCGAAGCGGGGATTGCTTTCAACTGAACGACATTACCCGGCTGATTATTGAACGTCACTTGCCACGTG
CACTCGTGCGTAGCGAGGAGAGTGCTGGAGCTCACAGTCACAGGACCAGTAATACCAGGAAGCTTGTTTAACTCTGATGCTATCGTTGTCGCGCCTTTCG
TACAGTCTCCGTCGCCTGCTTTATCCAGATAAATTGGCCCAGTCTTCGAGACCGCCCCGCCCTCCGTATTGCTAGTGTACACCAGCTGAATAGCCGTCTG
TTTCGACACTATCGAATCTCCACCTGTGGCTGTCGTATCCACTGTAGTCACCGCGATCTTCTGCACCTCGGGCTGTGTCGGCATGCATGCGCCGTTGTTC
ATCGGATTGGCAAAAATGGGATCGGTCGTAAGTGTCTGTCCTGCGAAGGTCGTCTGTAGCCGAAACGATGTCGTATCCTTCACGTTAGAGTTCGTTGTAG
TCACCTGTATCTGCTGTACTTCCTGAACGGTTCCTGGACGTGTCCTCACGACGCGAACGCCCATAGACGGCCCCGCACCGTCCGTTCGTGTCTCTCCTAG
TTTCGAGATGTCCGTGCCCAATTGAAGAAGGGATCCTTTCAGCGTAAGGAACGAAATGGTCCACGTATATCCTCCCTGTAGGTCCGGTTTCTCCGTGCGC
ACCACATCCAGAGTCCCAACTGTGCCCAATTTTTCCAGTTCACTTTTCATCGTGGCAGCGCTGCAGTCGAACGGTAGATCGCCTGTGGGGGCTAAATTGT
AGCTCAACTGGAAGGATCCCTTCAGTTGGTTCCCTGCCGTCCGCTCTGTCACCACAGCGTTCGCTCCTGTGGCTTTTAATGATTTCGACGCTACTGTCAT
GAGCGGCAGGTCGCCCGAATTGGAGTCTCCTGTAAACGTGACGTCCCAGTAGTATCCGTGCTGTGCGTCCGGGCCGACGCGCGTGACATCCACAGACTCG
ATCGAGGCGAGATCTTCTAGCGCCTTCTGCATCCCAGCGTCGCTGATATCTGCCTCCAGATCCTTCGTCGTGCTTCCCATGAATCTCAACGTGAAAAAAC
CACCATCGATCACGTTGCCTTGTTTTGGTGTGTTTATCACCACGTTCGCGCCACTTCCCGTCAGGAAACTGCTCGAAAGCGTGAGCTGCGGCACGTCACC
CATCGCCGTACTGAACGTGATGGTCCACGTGATGCCTCCCTGTGCGTCTGCCGTCGTCTTTTGCACACTCTGTACACCTGTCGGTCCTATATTCAACATG
GAATTTAAAATCTCCATCACACCTGATCGATCTCCAGACGCGGGGGCATTGAACCCGATGACTCCAGACCGCTGTACGCTGCCACCGGTCTTTGTTGTGT
CCAACTGGATGGTAAAGACCCCGCCCAGTGTCTCTCCTGGCGCCGCGCTCGTCGTGATCGTCTGTACTTCCGACACAGCCGTGGCGCTCGTGGTCACGCG
CTGGATCTCCTTCACGCGCTTCGCGTATGTCTGCACAGTCTGCACCTCGTTCGCGCCGGTATTGGCCCTTGTCTGCACCACTTGCACTTCGCGAACACCC
GGATCCGGGTCCCATTCCACCAAATACGCCGACACGGGCGAGCCGCCGTCCGTCGCGGGCGGTTCCCAAGCAAGAGCGAGTGCGTCGGGCCCCAGCACGT
CCAGCGCCACGTTCAGCGGGACCGAGGGCACTGGCACGTCGGCGTGCGCGATGTGACTGGCACCCAGCGCGGCCCACGCGGCTGTTAGCAAGTGCCGCAT
GGCTGTCGTTGTCGTTGCCGTCTCCTGTGCTCTTGACGCGAAATCTTTTGCGAGACCTACGCAGGTGGTACGCGACGCTTCAGGATATGGCTACAGCTCG
AGCATCGAAATCCACGAACACCGAAATCAATTCCAAAAAGGCGACAAGAGAGTAAACTAATGCAACTCATTTCCTGCAACGGCAGCTTATTCAATGCGTA
GAACGCAGCGACCTACTTGAGGAGGTCCGTCATGATCAGACGCCGCGGAGGAGCTGTGGCTGGCGGAGCCGGGACCTCATCCAGAAAATCCTGCTCCGAA
TGAGGCAACCGGCAGGTGCTATATTATCTATCGTCGTCAGGGCTGTAAAAAAGAGGGGGGGTTGATTAATGGAATAATGGAATTTTTGGGTGAAACGCGT
TGAATAAACCAAAAAGCTGCCTCCAACTTAAATATTGTACTGATAAAATCCATTTCAATTCACCCATCCACTGAGCTATTACCCACCCTTTAAACACGGG
TTTTTAACAACTCTAATCATCGTGGTGCGGAATGAACTTTGCACGCGAAGGGTGTCTAACCTACAGTAGAACCAGCGCGATATCTCAGGTCGTGAAGCTG
GCCCTGTTGGAGGTGTCCACGATTCCACACAATGTGCTCAGGTGAGGAGCTACTCGATAAGTGTCGTACACTTCGTTTGTGTTTAGGCATCAACGCTTGC
CAAACGCGGTGACAACTCGCTGGTGTTTGCGCTTGCAACTCACAGTATCCCGACCAAGAAACTTTTTCATATCAATTGCAGGGCTGGAAGAAACTCTACC
GGTAGAATCGATTGACACTCCTGTTTCAACAGCCTTTGCAGCTCGAGCATTCTCAACTTCACATTTTTTCGCCGTTCGATCAGCAAATAGCACCTTCCGC
AGTCTTGCTTTGGTCGCCGAGCTTCCTGTTCCATCACGACTGGTACTTTTCCCCATGGGTAGTGCCCCTCCTGCCCCCGTCCGGCGCTCTGTCCAACGAT
AGTTGGGTGTCATGCTCATGCCCACATGCTTCCATCGCTGCTTCGCAGCTTGCACTGCCGCTACTCGTCGCTTCAGCTCTCGCGTCTGAAAGGCTAAAGG
CTCCGTGTCAGGTCTTGGATACGCCACAAAAGGCGGGCTGGAGCGTCGAGGTTGCTTGGTATCCTGCCGTCTGCCGTCGTAATCTTCCACAGATTTATCC
GCTTGTTCGCCCGGCTTCTTGCACTCGCAAGGCTGGAAGCGACAGCAAGCGCCGCTGCGGAGTCCAAGCGCTCCTGCACCACCAACAGCCGTCTTAACGA
TACGGTCAGCGTTGGACACAGCGTACGCTCCTGGTCCAGGGACAGAAGAATTCTTGTTCAGCCAGTAGCGCGCGTTCTTCTTGGGATTTCGACCCGAACC
GAAGCTGCAGCCTCGAGTCGTCTTGGCCACTGCCACAGCTCCAGCTATTATGTCGTCCTGCTCGTCTCGAAGTAGTTTATCTATCTCCTGGAGTCTCTTA
CTCGCCTCTCTCCGCTGCTGCAGCCCTTCCAACGCTGTAAGGAGCACTCCATCGAGACATCGCATCGTCCTAAAGCAGACTTCCTGCTAAATACCAGCAT
GGAAACGGACAATGGAGTCATATATTTAAGCCGAAACAGCTTAACTATCCTTAAGCTACATAGGCCGGCAGCGCGGCGACAGCGCTGCCTTTGGCGTGGT
CGATCTTGAGGTGTCGCCGCATCTGGCGGATAGCCCGGGCCGTCTCCTGCCAGGCCGCCGTGCGATCCTCACGTACGGACCCAGGGATATCGAACCGTTC
TCGAACCGTTGAGCGCAGAATCGAGATGCGACGTACCAGCAGCAGCGAAGGAATGGCCGTTAGCACAAGCGATCCGAGAATCGACGCGATGCGAACCAGG
ACGCTGGTAGAGTCGCGATAGGCCTGAGAGTAAATCCACAGGGCCACAAAGACCCACAAACCCACGAGTGCCAGTGTCAACAGCCCGTACGCGGTCGTAT
ACCAGCTTAGAGCTCCCGTGTACGAAGTGAGCCCAAGCCGAACCTCAATCTGCGCCAAAGGAATGCATGGACAACAGGCCTCGATGTTGACGTTGAAGGC
GATGAAACCTTCAGGCTCCTCGGGTATCACGGGGCTCGACCATTGGCCCACCGTGATGCCATTAGCGTCCTGTCCTGGAGGGGCTTGCAGCTCCGGCCCA
CCATGCACTGTTTTCTCGGCCTTCGGCGCGGACATCGAATCTGTGGCAAAACTGATTCGCATCAAATATTTTGAGACAACCTAATTCTAATTGATTACAG
CGAGGCAAAACTTTCGTGATTATTTTTTTTTTGCCTGCAGAGCAGACAGCCAAGATCATTGTGCGATAACACTAGGTGCCAAACAACACGACAAGCAGTC
TTGGTGAGCAAGTTCCAAGGTTGGACGCGATATCTACAGTAATGCACAACCGTGGTTCTGTTTTCACCATGTGAACGATTGAAATATTGTTGTGCGCACC
ACAACGAGCGTCGTGGGTCTTTGTCAATGGCGTGTTATCTACTAGCACTGGCTGCGCGTCCTCAACGTTGTGCTGCTACACGAACAACATCATCTTCAGC
AGTATTCCCGCATAAAAACAGAAGTCGATGAAAGAATCGAAGTATGAAGTCTAGTGTATTGAGGGTCAAGTAGCTGCTGTATTCGCTGTGAGTTAGTACG
CACGACGAAGTGCTGCGCTACTCAGCCCGACATGAACAAAGATACAACAAGCTGTTTCCCGCCTCAAAACCTTGACGGAACTTCCTTCCGTTGCCGTCGA
TTGTCTCCAGAGCTAGCTGGAGGCGCTTAAGCGCGCAGGAAGCGCGCCGACTGCTGAGCAGTCTGCGTGTAGTCGTCGTCAGGGCTCTCCGCCGACGGGG
TCTCAGGCTTGCCAGCGCCGGTCTTTCCCGTCTTGCCGGACTTGGTCGGCGTCGTCGGGGCAGGCGTGGTAGTGGCAGGGGTAGTAGTAGCCGGGGTCTC
CGTCACAGGGGTCTCCGTGGCAGGGGACGAGCCCGAGCCGGACTGGTTAAATGCCGAGCCAGAGTTAGACTGAGCGGGGCTAGATCCAGAGCCCGAGGTG
GACTTTTCAGTCGAGTGAGAACCCGCCTCCGAAGTAGGAGTGGTGGCGGCCGGGGTCGAGGTAGGCGTCTGCTGCTCAGGGTGCGAGCCCGAACCCGAAG
TGGACTGAGCGGGCGAAGAACCAGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCACCGGGGTCTCCTGGCTGGGGGACGAGCCCGATCCGTTCTCCGAGGTAG
GCGTCGACGGAGCAGGCGTAGTCACCGGGGTCTCCTGGCTGGGAGACGAGCCCGATCCGTTGCCCGACGAAGGCGTCGACGGAGCAGGGGTGGGAGTCGG
GTAGCTGTACTCGAGCGTTGGGCACGGTGTATCTTCCTCACCCGATCCAGTCGAAGGGGTTTCCTGGCTGGGAGACGAACCCGAGCCGTTGCCGTTCTCT
GTGGTAGGGGTCGAGGCAGCAGGCGTAGCAGGCGGGTAGTTGTACTGCAGAGTAGGGCACGGCGTGTCCTCCGCACCGCTGCCCTGCTCCGAGGTCGGGG
TAGTAGCAGCAGGGGTGGTCGACGGGGTCTCCTGGCTAGGCGACGATCCCGATCCGGTAGACGGGGTCTCCTGGGCAGGTGTTCCCGGGGGGTAGTTGTA
CTGGAGGGTAGGGCACGGCGTATCCTCCGCACCGCTGCCCTGCTCCGAAGTTGGAGTTGTAGCAGCAGGGGTGGTCGACGGTGTTTCCTGACTAGGCGAC
GAGCCCGAACCGGTAGACGGGGTCTCCTGACTGGGAGTAGAACCCGATCCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGATCCTGTGGATGGGGTCTCCTGGC
CAGGGGTTCCCGGCGGGTAGTTGTACTGCAGAGTCGGGCACGGCGTGTCCTCCTCGCCGCTTCCCTGCTCCGTCGTGGGCGTCGTGCCAGCCGGGGTAGG
AGCGGGGTAGTTGTACTCCAGGGTCGGGCAAGGAGTGTCTTCGTCCGAGGAACCAAGCTCCGACGTCGGGGTCGTGATGGCCGGGGTGCTCACGGGCGTC
TGCTGTTCCGGGTGCGAGCCGGATCCGGTGCCCTGCTCCGTGGTTGGAGTGGTAGGAGCCGGGGTAGTAGAAGGAGTCTCCTGAGAAGGCGACGAGCCCG
AGCCGGTGCCTGACGTAGGCGATGACGGAGCAGGCGTGGACGTAGGCGTCTGCTGCTCCGGGTGCGATCCAGAGCTTGAGCCCAGCTCGGAAGTCGGCGT
AGTAGGCACGGGTGTGGTAGCGGCCGGAGTGGCTTCGGGGGCCGGCGTCGTGCCAGCCGGAGTCGACACAGGCGTGGCCGGAGTGGCCTCGGGGGCAGGC
GTCGTGCCAGCCGGAGTAGACACGGGCGTGGCGGGGGTCGACACAGGCGTGGCCGGGGTAGTGGCCGGGGTCGACACAGGCGTGGCCGGGGTAGTGGCCG
GGGTCGACACAGGCGTGGCCGGGGTCGTGGCCGGCACCGGCGTGTTCAGACCGGACTTGCCACCGTTCTGCGTGTACGTGTCAGCTGAGTTCTCAGTGCC
GCCAGGCGAGTAGCTGCCGGCGTTGTCAAACGTGATGCCGCCGCCGCCGCCACCAAGCACGACCTGCATAGCCATGGCCGCGAGCACGATGGTCGTGTAC
ACCTTCATGGTAGTTTACTGTAACAGGAGACGAATAACACGCTGTTGGATGGACTAGAAACGGGAAACGGGAATCTCCAACCGGGGACGACGCTGGTAGG
GCACTTCGCTCTCGGGAGGAAATTGGGGAATGAGGAGCACAGAGGAGAGCATGCTGCCGCTCATATACGAATCGACGATGCAGGGGAGCGGCAGGGAGCT
CTCTCGCACTAGGCGCTTATCCTGGACGAGATTTTGCACTCGGCCTCTTGGTCTCACTATGCCCAGCCCTATCTTTTACGCGTGCACGACCATGTGTAGC
GACGAGCCCCAGCCGCTGACTCCCTTTGCCGCGTCCTCAGTCTCCGCTTACTCGGGCCAAGTGCTTTTCTGACTTCGGACGACGTCGCTGAATTGCGCTG
CCCCGTATCCCACGGGAAGCAACAGATGCCGCCGCCTTGTGGCTCTGCACGCTGCTGGCTCGTTGACGACACTTTCGCTGCGAATGTTCCTCATCTGCAG
CGATGGCAATGCAACAATGGAAGCGGAGACTTCGGTCTTCTTGACCGGATCGCATCTTTCGATCTAGCAAGCTACGCCTAGTCATACTCATGTCAAGGTT
GACACGGATCATCTCGCTGAAAGGCAAAGCGGCCAAGGTTGACGGTCACCACTGCAAAACCGCCAACTTGACGGCGAAAGTCAAATTTGGCATCGCCACA
GCAGTGAGCACTGCCCTATGCTGTTAGCTCACTATTAACCTAGCTGTCGAGAACGTTCCGCCGTAGCTGCAGGCAATAGTCCTTATGGCTGGCAAACCCA
GTGCGGCATCGCCATCTGCGCCCAGACAGGCTTCCGGCGCGAGTATCCACCGCTTATCACCAGCCTCGCGACGGCACTACACGCACGCAATGGGGACGCA
CGCGATTGCAAAAATTGCAAGTCGACTACAGTTGGCCCCGCACGGACCGAATACACAGGCCACGTCCCATACTTGTGCTGCCTCGGTCAAGGATTGACTC
GAGCGGTGTGCCTCCGACATCTTGCTGCGGCGAGATTGTCCGACACGGTGCTGCTGCGCTCGGTTGTGATCGCACAGAAAACTGCGTCTCGGTGTTCAAC
CAGTCACCCTGGATAGGGCGCGGTGGATAACACATCGACGCTGTTCGTAACACTGCATGTTGCTCTCTGTAAAGATCCACCATGAAGTGCAATTGAAGCC
AGCCCACTATGGGACGGGCGGAGCTGCCGTCGGAGCTGCTTGCCTCTGTGCTACATGTATTATTTAGCCGATCGGCTTCTCGGCAAGGCGTGGAAGTTCC
AATGGAACGGCGTGCTTGTGCGGACAACTCACCTGTGACGTGTGTCTGACTACCTAGCTCGCGGATCGCCGCCACAACACGAATGGAACGGGCTGCCAGC
TGGAACACGTTGAAGTGCGCACCGCCGTCTTTGGATCGGATCGGGTCCGTAGGACCAGCTCCACCGTCAGGCTCTTGTCGGCCACAGCGACTTCGAACAA
CAAACTCTGAGCTGGGCGGTGCTGCCTCATCAGGCGTTGCAACGACAGCCCGCGACAAGCACGTTCGTCGCCTACGTTCTCGCCGCACGACTGCAAGCTG
ATGGACGATCGTCCAATTGAATATTGAGATACCTCAGCGTGTAGCCATGCATCGAAGAGGCAGGACCACTTCAACATGCCGGTTCGTTACGTGTACGCTA
TCTAAATGCGGTGCGGGATGCTTGTCGGCAGGGTAGCAGAAACCAGCAACGCTACGGTGTTTAACACGCGCAAATCATGAGCGGGCGAAGTCCCTCTTCC
AGACGCGATAGTCTGTCCGAGTCCGAGTCCGAGATGAGCATCGGTCCCGGCAGCGTCGACAGCGTCAGCACTCTGGGGCGACGGAGCAAGCCGCGCCACG
TCATTTACGAAGGCAGCGAGATCGACGACACCGACGCTCACAGTGAGCTTGATGTCAGTCTATACGATACGGACGAGGTCATGGACACGGAGCGCACCAG
CTACCGCATCTCGCTAGGCAGTGACGGCTTCGAGTCCATCCTGTCAGACCCGGACGCTGTACACGAGGACGTTGACGAAGAGATCACATTCCCGTCCCAC
CGCAACCGTGTCGCTTTCAACAGCTTCGTGAGCGTCGATACGGCGACTTCAGAATATGAGCCGCCGCATCCGCAGCGAGGTCCACCACTCCACTTGCAGC
AGCTCCACCAACAGAACCAGCGCCTTCAAACGCTTCAACGACAGCAAGAGGAACAGATTCAGGAGCAGCAGCAGCGATTCCCTGGTGCCTACGAAGCGAG
TATTTCGTCAACCTCATTCTACCAGTACCTTCGTAGCAGCCTCGCTCTGGGTGGCGCGACTGCAGATAATGGTGGCTACCCGCCTTATATCGCCCCACCG
AGGGCTTCGATGAACCCCGACCCAAACGTCCGCACAAACTTTACCAGTGCATCATCAAGAGACGCACCGCTCGGTACTCCTGGCGATGCGTACGATGTTC
TGGGCACGCCACCGGGAGATCCACCAGCCTCCCGACCCTCCCAACCTCCGTCGGAGCAGAATAGAGAGTCAACACCATTTGATGCAATCCACTTTCAAGC
GCTACAGCATCCACCTCGATCCATGAATTCATTTCTACTGATTCTGCTCATGGGTGCAGGCTTTGGTATCGGCTTTGCAGTTCTCTCTGCTGATCCACCC
AGTGCCTATGGCTACTGGCTCAATGAGGTGGGCACACTCTACATCCGCATCGTCAACTGCACAGCCGTGCCCATGGGAATCTGCCAGGTGATCTTCTCTG
TGTCCACGCTGACTGCGCGTGGAGCCTTAGGACGGCTCTGGCTCAAAACATTCGGCTTCTACCTCGTTATTTGTCTGCTTTCAGTGATGATGGCCATCCT
TGTGGCTAGCGCGCTTCGGCCTTCGCTGAAACAGACCGACGTGCTGAGTTTCGAAGTCTCCAGTGCTCAATTTGGATTCCAATGCAGTAACAACAAATAT
CTCGAGCTCAACAATTCGACACTAGCGTGCAGCTCTGACAGCTTTGACGACGCGAACAGCACCGCGGCCGTGTTCCCAAGCTTCGTGGATGTGAACACCG
TGCTGGGTCTGCCCGAGTCCATTCCACAGCTGAGTTTGACGCAGTATCTTTTCCAATTAGGCTATCGTTACGTTCCGAACAACGTTGTCCAGGGGCTAAG
TGCCGACTACCATATTAGCTCTATGGTGATCGCCACTGTTCTGGGCGTGGCCGTCACGCGCAGTTTCCGCGGAGGTGGTGTGGGACGCGAGCGGGGCGAT
GCCAGACGTAACCCGTTACTGAGACTATTCGTTCACATGTACGCAGCGCTGTTCACAATCTTGGACTGGCTGCAGTCACTGGCGCTGTTAGCTATCCTAC
CGATAACCATCGGATCAATCCTTGTGGACCCTGCGAACGCGAATCTGGCGTCGTTTGCTGGGAAATGGTGTCTCGCCGTATTGCTCGTATGTTCCATTCA
GAGTCTCGTGCTCTGTCCGATCCTGTTCTTCTGGGTCACGCGGCGTCAGCCTTTCGGATGGCTGCTAAAGGTGTTGCCGGCGCTGCTCTACAGCATTTTA
CTACAGTCTCCAATTCTACCCTTGCCTATCGCTACGAAAAGTGTGCTACGGTCGCGCGAAGTTCCGCCTGCCGTATTCGGAGCGCTGTTTCCGGTGTTGT
CGGCATGCAACCGTCTCGCTCAGGCAATGACACTTCCGATTATCTTGATGTGGGTGGTGGGCTATACAGACTGTGGACTGCCACTAAACTTCAGCAACAG
TGCCCTGCTTTTTAGCTACGCACTCATCGCCAGCTTCGGAGACACGGCGTTACCGCAGTCACACATTGTGTACTTCATCACTGTCTGGCGCGGCTTTTGC
GGCGTCGAGCACTTGCCGCCCACGCCGATTGCCATGAGCGGCGTCACGCTGCTCATCGGTAGACTACAAGCACTCATCAACACAGCCACCAACCTGATGC
TGGTGCGGATGGCGGCCAGTACGGACGAGGGCCGCATGTACGCGCACCACTTTGCCGTGTAGGTAAAATAGTTGCGGTGCACTTCCGTACAGCAATGCGC
ACATTTAATATCGCACACGTTAGTTCTGCTCGAAAGCTTCAACGAAGTCTAGCAGGAGAACGCTTTAGGCTACAGTTTAGCTGCATCGCGTACAAGTTCT
GCTAGGACCAACAACTATTAATACGCCGTAGGTTTATCCGAATAGGTTCACTCAAGCACTTGCTACGTTGAAGAGGCACGGCACTAATGGATAGGTTGTC
CAGCTGTAGCCAAGTTCAAGCATTGAGTGACATGGACGGTTGCACTAGCATCACTAGCGCCACCGATTGTCCTTTTTTCTGTTTGAAAAACGCTCTGCGG
TAAGTACGAGTATTGGATTAGAAAGGATATTCGTTTGTGAAACTCGCTTTGAAACTTTTTTGTATTTGTACATGTTACTGCACTGCGCTATATAAAAGAA
AGTTAAATAAACAATCAAATTTCAAATGTATTTGTTACGATAGCTGGCCCATCCCCTCGAGATCTGTCTCCTCATCAGAGAGTCAGCATCTTCTGGACCA
AGTCTCCATCAAGCTCGTCGCCGCTCATGGGGCCTCGTCGCCTCCGCCTTGCGGCCGTGGCGCTGTCGTTCCTCTCCCCCTGCGCCGCCTCGGCCTCGGG
GCTGCTTCGCATTCCGCTGGAGAACTACGACCAGATGCAGTTCTTCGGCTTCATCGGCGTCGGGTCGCCTCCACAGCGTTTCCAGGTCATCTTCGACACA
GGCTCGAGCGATATCTGGCTGCCCGAGACAAGCTGCGCGGACTGCGCCGGCTCTAGGCGCTACCACGCGGCCGTTTCGCGCTCTCACGAGCCGCTGAACG
AACCCTTTCGCCTCGAATACGGCAGTGGCAACGCTTCGGGTCGTGTTGTTCGCGAGCAGATCTCGCTCTTTGGAGGCGACGCACAGGACGAGCTTCTGAC
GCTCTCGAAGGTGCAAATAGGCAGCACCAGCAAGACAACGAAGAGGTTGCAGCGCTTCCAGGCCGACGGCATCGTAGGGCTCGGCCTCGAGGAGCTGGCG
ATCATCACCAAGCCTAGTCTTCTCAAGTCTGACCCGCGGCTGGGACGCTTCTCAATCTACATTAACCCGCTGCCTGGTGCATTGCCACCGGCACAGCTCA
TCTTCGGCGGTGTGGATGACTCGCTGCCTGTTGCTCACATTCCGGAGGCGAACGGAACACACGTTAGCTGGCACCACTTCCCTCTCGTTAGGTACCCGTC
CAGTAGACGTGCACACGGCTTCTGGGCCATTCGGTTGCATCGACTCGCAGTTGGACACTTTGATTCTCGATCAGAGTCAAGCTCGAAGCAACTAGCAGGT
AGTGGAGAGGGAATCGTAGCGGTCTCTGCAGCTGTGGCTATTGTAGACTCTGGCACTTCACTACTGCTGCTTCCGCGACGAGCCTTCGACGCCACAATAG
CTGAAATTCGGCAGCATTTGCGCGTACAGCACGGCCGAGAGCTACGTGCGGACCCTCATGTAGTGAGCGGATACTCTTGTGCAGACTGCACGGCGGAGAT
GTTCCCCGCTCTGCGATTTAGTTTTGTGATAACGGAAGCGTCAGTTGATACACAGATGAAGACGCAGACGTTAGTGCTGCGGGGCACGGACTACGCGCGC
TGTGACGACCTCATCTGTGCTCCACAGCTCGACGTACACGCACTGTTCACATCGAAGAAGACCAAGAGCAAGCTGGTGATCCCTTCTGCTTCGGCAATGA
CTACCAATGTTCCGCAAGAGATGGAGCACGAAGAAGTTGTGGTGCTTGGTGTCACGTTCCTGCGCGCGTACTACGTGCAGTTCGACTCGGAGCGCAAGAC
CGTGGGGTTCGCCTGCGTCGGCTCGGCGTTGTCTACTGCAGCGAATGTCTGCTCCGGCGGTTGGACGCCCAAGCTCCAGTTCCACTCGGCGCACTTCTCG
GACGCTGAAGCCTCAGCGTGGCGTGCTGGTTGGGTCTTCTGGTCGCGGGTGTACTTGGGTATCGGTGTGCTGTTGCTGGTGGTGGCGTTTGCGCTGCTGT
GGCTCATTCTGGTGGTACCGTCGTCGGATGTCGAGAAGGTGCTCGACTGGCTCTACGGACCCAGCGACAAGAACCGAAGGCGACAGCAGCAAACGGAGTC
CAAGCTAACGCCAAGTCGGCGGAGCTCGTATCAAGCTCTGCAGATCGAGAAGGCCAGCGACAACAACCGAGGCGACGAAGCCTCAGAGGAGCCCGACTCG
GAGCCGGAGTCGCCTCACGCATCATCAGCAGCACCGTCAAGGCGGAAGAGCGTGTGCTTCGACGTGTAGACAGATAGAGTAGATCAAATAACAATATTGC
AATGTACAAGTAGCTCGGAACAATTTTACGCTCGAAGTTGAAGTTTTTGTCCGTAAAACTTCGTTGTTATTCGTAAAAATCGGTTAAAATATCCTGATAA
TATTTCGATCGGCAGAGAAACAGGTCTCTATTATCGCTGCGGCGCCGGCCATGGAGCTGCTCAACAAGGTCTGTCTGTTCGGCGCGCGCCACTGCTTCTA
CACGCAGTCGGCGGCGGCTGGCGCGGCTTACTGCTACGCGGCGGTGCTGGCCTACACGCTATCCGTGAGCATCCAGCGCGCTCGCCTGGGAGAGCACGGC
CACGCGACGCACCTGATGCCGGTCAAGCGGATGCGCTGGTTCCCGACGTTCTTGAGCTTCGCCTACTTTTCGCGTATCGCGTGGCTGGTGCTCAGTAATA
TGCACATGTTCCAGTGGGTGGAAGGCTCGGCGCCCAACTTCCGCTACGAGCACATGGTGTTCGTCACGCCACTACTGCCGACTGACATCGACATTTACGT
GCTGGGCGTTACGAGCTTCGGCAAGCTGGCCACGCTGCTCTACTTCTCGGCCTTCACGCTGCTACTCCGTTTCTGGGAGGACGTGCGCACACAGGCTCGG
CGGGCCGAGCAACCGTTGGCCCGAGTGGCCGCTAACCAGTCCGTCATCGCGGAGTATACGCGTGGAGCCGGCGCTCAACGGTCTGGGCGGTCCAGGAAGC
TGTTCCTCGTGGCTAACGTCTGGATCTACCTAGTAGAGTGCGCCCTACTGGTGCTTAAGACCTTGTTCCCGGGGGAGAAGATGGTGCTATTCGAGATGGA
GTATGGCTTCGTGGCCCTGTGCTTCTTCCTGCTGGCCGTCATGCTGGCCAGGTGCGCGTTGCAGCTGCGCGCCGTGCTGCTCAAGATCGAGTTCTCGTCC
TTAGCGGCCACCATCGCGTCGCGGCTGTCGCTCATTGGCGCTGTATCGTCGCTGCTCTTCTTCTATCGCAGTTTGCTGCTGCTCTTCTCCATGCCGGCCA
TCGACGTCTTCGACCCGCACGTGTCAAACCCGTGGCTGTTCTACGCGATCCCGGAGCTCATCCCGGGGGCCTTGGTGATCTACATGATGAACGTCAAGAG
GCAACACCAGCCACCGGCGCCAACATGGGGGATCACAAAGGTGGACGAGCAGACGCCGTTGCTGCAAGAGTTGCGAAGCCTTTCCGACGACCTGCCGCAG
TTCCGAGGGCAAGAACTGCACATCTAACCTTATTACTGTAAATTTTGTGCAATAGATGTTTGATTCAGACGGGCTACTTCAACACAGAACTACAATTAAT
GGCGATTGCTAGTCGTCATCGCTGCGAGGTTTGTTCCAGACCCACTTGTTGCCCGACAGTTTGATACCTTCTTCGACTGGACAGCCAGCATGCAGACTCA
TTGGATCTCCTTCGCCATTCGGTAGCATGCTGTAGAACACGACCACTTTGCGCTTCTTCGGCGCGACGCTAATGCCCTGTGAGCAGTCCTTGTTGGAAGA
AGGGCGTGGCAGGCCACCTGAACGAGCGAAATTGGTGTGGCCGCCCTTGGCCACGTCCGACATGTACCAGAACACCGTGATCATGCGATTCTTGTAGCCG
TATTCGATCCGCTTTAGGACGTCAAGCGAGTTACGATGGCGTTCAGCGGAGAAGTAGTCCAAATGCTGGTCGTAGTGCTGCGTGTGCTCGTAACGC